Arum orientale

M.Bieb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Arum

At a glance

Occurrence records480

Data sources9

Biological traits19

DNA specimens7

eDNA detections14

Sources9 archives

Databases and archives Arum orientale's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility480 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources19 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF480 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Аронник восточный — многолетнее клубневое травянистое растение, вид рода Аронник (Arum) семейства Ароидные (Araceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLEDAGIFTWCVPTRY

Size & morphology3

Seed mass32.6 mg

Seed mass max32.6 mg

Seed mass min32.6 mg

Life cycle & reproduction6

Dispersal typeanimal

Flowering endMay

Flowering startApr

Life formtuberous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Arum orientale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Carbocyclic fatty acids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
13-Phenyltridecanoic acid		present	LOTUS
15-Phenylpentadecanoic acid		present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arum orientale has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences5

eDNA detections14

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLEU193240.1 ↗1 242 bpSwitzerland

ACGT

CCTGACTATGAGACAAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCGCCTGAAGAAGCAGGGGCTGCA …

Arum orientale isolate A28 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arum orientale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode17records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2817×CCDB · fl-europaea · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3

CCDB · fl-europaea — Beuret, 1972

CCDB · ipcn-api-dl — Alpinar, K. 1986. Some observations and findings on Arum L. (Araceae) species of west Turkey. Doga, T;auurk Biyol. Dergisi (Turkish J. Biol.). 10: 240–253. (In Turkish).

CCDB · ipcn-api-dl — Alpinar, A. 1987. Chromosome Number Reports 94. Taxon 36: 285.

CCDB · ipcn-api-dl — D'Emerico, S., P. Bianco & P. Medagli. 1993. Chromosome numbers and karyotypes in Arum (Araceae). Caryologia 46: 161–170.

CCDB · ipcn-api-dl — Bedalov, M., C. Dragulescu & P. Küpfer. 1998. IOPB chromosome data 13. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 17.

CCDB · ipcn-api-dl — D'Emerico, S., P. Bianco, P. Medagli, M. Bedalov & F. Piccarreta. 1993. Indagini cariologiche su alcune specie di Arum L. (Araceae). Giorn. Bot. Ital. 127(3): 514.

CCDB · ipcn-api-dl — Bedalov, M. 1981. Cytotaxonomy of the genus Arum (Araceae) in the Balkans and the Aegean Area. Bot. Jahrb. Syst. 102: 183–200.

CCDB · ipcn-api-dl — Bedalov, M., V. Bronic, A. Antonietti & P. Küpfer. 2002. IOPB chromosome data 18. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 34: 18–19.

CCDB · book-ipcn67-71 — ZAKHARYEVA O.I., & L.M. MAKUSHENKO. 1969. Chromosome numbers of monocotyledons belonging to the families Liliaceae, Iridaceae, Amaryllidaceae, Araceae. Bot. Zurn. 54: 1213-1227.

CCDB · book-ipcn67-71 — TARNAVSCHI, I.T . & r. LUNGEANU. 1970. In IOPB chromosome number reports XXVIII. Taxon 19: 608-610.

CCDB · book-ipcn67-71 — TARNAVARSCHI, I.T., & I. LUNGEANU. 1970. Chromosomenzahlen von einigen in Rumanian wildwachsenden Anthophyten. Rev. Roum. Biol., Bot. 15: 381-383.

CCDB · book-ipcn75-78 — Loon & Oudemans 1976

CCDB · book-ipcn73-74 — BEDALOV, M. 1973. In IOPB chromosome number reports XL. Taxon 22: 285-291.

CCDB · araceae — Bedalov et al., 1998

CCDB · araceae — Petersen, 1989

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type480 records

Wild obs. + sensor400

Museum / vouchered79

Cultivated / captive1

Origin

Introduced1

Range

Area of Occupancy AOO1 204 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 219≤1 km 27≤10 km 28>10 km 18

292 georeferenced · 108 without coordinates

Open the mapobservation + sensor400

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 5≤1 km 7≤10 km 10>10 km 2

24 georeferenced · 55 without coordinates

Open the institutions mapphysical evidence79

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	24
Moscow State Universitylocation not on record	24
BRNUlocation not on record	4
Wlocation not on record	4
Görlitz, DE	2
Saint Louis, US	2
Bronx, US	1
GJOlocation not on record	1
Chicago, US	1
Philadelphia, US	1
Tromso University Museumlocation not on record	1
Karlsruhe, DE	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
GZUlocation not on record	1
LDlocation not on record	1
Edinburgh, GB	1

16 institutions · 70 of 79 vouchered records shown · 7 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Arum orientale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.50 °C -2.50–2.80

Seasonal swing summer↔winter19.1 °C

Max temp (day)0.9 °C 0.9–6.50

Min temp (night)-7.30 °C -7.30–-1.80

Precipitation175 mm/mo 128–175

Air humidity60.2 % 60.2–60.4

Moisture balance118 mm/mo 52.9–118

Vapour deficit219 Pa 219–338

Wind speed6.90 m/s 5.60–6.90

Cloud cover46.7 % 46.4–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)