Arum nigrum

Schott · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Alismatales/Araceae/Arum

At a glance

Occurrence records17

Data sources9

Biological traits10

DNA specimens6

eDNA detections6

Sources9 archives

Databases and archives Arum nigrum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 28

01Narrative

لوف أسود هو نوع من النباتات يتبع جنس اللوف من فصيلة اللوفية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formtuberous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Arum nigrum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Carbocyclic fatty acids2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
13-Phenyltridecanoic acid		present	LOTUS
15-Phenylpentadecanoic acid		present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arum nigrum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences6

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGU067559.1 ↗813 bp

ACGT

GGAAGTAAAAGTCGTAACAAGGTTTCGTAGGTGAACCTGCGAAGGATCATTGTCCATCCTACCACTCGCGCATCGCGAACGGTTGACCCT …

Arum nigrum 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arum nigrum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 284×CCDB · ipcn-api-dl · CCDB · araceae

CCDB · ipcn-api-dl — Bedalov, M., P. Bianco, M. Hesse, P. Medagli & Č. `ilić. 1991. Comparison of Arum nigrum Schott and A. apulum (Carano) Bedalov. Bot. Chron. (Patras) 10: 861–868.

CCDB · ipcn-api-dl — D'Emerico, S., P. Bianco & P. Medagli. 1993. Chromosome numbers and karyotypes in Arum (Araceae). Caryologia 46: 161–170.

CCDB · ipcn-api-dl — Bedalov, M. 1981. Cytotaxonomy of the genus Arum (Araceae) in the Balkans and the Aegean Area. Bot. Jahrb. Syst. 102: 183–200.

CCDB · araceae — D'Emerico et al., 1993

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type17 records

Wild obs. + sensor14

Museum / vouchered3

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 7≤1 km 2≤10 km 2>10 km 1

12 georeferenced · 2 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Berlin, DE	1

1 institutions · 1 of 3 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Arum nigrum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.50 °C -2.50–-2.50

Seasonal swing summer↔winter19.1 °C

Max temp (day)0.9 °C

Min temp (night)-7.30 °C

Precipitation175 mm/mo

Air humidity60.2 %

Moisture balance118 mm/mo

Vapour deficit219 Pa

Wind speed6.90 m/s

Cloud cover46.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)