Arum maculatum
speciesAt a glance
Occurrence records398 677
Data sources13
Biological traits42
DNA specimens44
eDNA detections117
Sources13 archives
Databases and archives Arum maculatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility398 677 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI117 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics44 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources42 traits
Chemical compositionLOTUS65 compounds
Occurrence & distributionGBIF398 677 records
Environmental DNA2 datasets · 5 countries117 detections
DNA & barcodingBOLD · NCBI44 specimens
Genome at a glanceCCDB · GoaT10 Gbp
01Narrative
L’Arum tacheté ou le Gouet tacheté est une espèce de plantes à fleurs de la famille des Araceae. C'est une plante herbacée des régions tempérées. L'inflorescence sapromyophile émet de la chaleur et diffuse des odeurs d'excréments pour attirer de petites mouches qui assurent la pollinisation. Il est parfois appelé la Chandelle, le Pied-de-veau, le Manteau de la Sainte-Vierge, la Pilette ou la Vachotte.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass245 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 8 105 mm² · GIFT: 10 497 mm²
Plant height0.242 m
⚠ sources differ — GIFT: 0.242 m · LEDA: 0.242 m · TRY: 0.32 m
Plant height generative0.262 m
Plant height max0.45 m
Plant height min0.15 m
Seed length8.1 mm
Seed mass34.09 mg
⚠ sources differ — TRY: 34.09 mg · LEDA: 33.01 mg · GIFT: 93.28 mg
Seed mass max510 mg
Seed mass min4.54 mg
Life cycle & reproduction13
Deciduousnessvernal
⚠ sources differ — TRY: vernal · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endMay
Flowering startApr
Life formtuberous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Seed number29.4
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typeberry
Growth formherb
Habitat GIFTforest
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry6
Leaf dry-matter content (LDMC)118 mg/g
Leaf n42.45 mg/g
Leaf p3.75 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)32.27 mm²/mg
Other traits2
Diaspore typeone-seeded generative dispersule
Plant support typefree-standing
03Chemical composition65 compounds
Compounds documented for Arum maculatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones8
Oxygenated hydrocarbons4
Carbocyclic fatty acids4
Aromadendrane sesquiterpenoids4
Cinnamic acids and derivatives3
Documented compounds65 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (-)-alpha-Gurjunene | present | LOTUS | |
| (-)-Caryophyllene | present | LOTUS | |
| (1aS,4aS,7aS,7bR)-1,1,7-trimethyl-4-methylidene-2,3,4a,5,6,7,7a,7b-octahydro-1aH-cyclopropa[e]azulene | present | LOTUS | |
| (1R,2S,7S,8S)-1,3-dimethyl-8-propan-2-yltricyclo(4.4.0.02,7)dec-3-ene | present | LOTUS | |
| (1S,4S,8aS)-4,8,8-trimethyl-9-methylenedecahydro-1,4-methanoazulene | present | LOTUS | |
| (2R)-1-Methyl-2-(9-phenylnonyl)pyrrolidine | present | LOTUS | |
| (S,1Z,6Z)-8-Isopropyl-1-methyl-5-methylenecyclodeca-1,6-diene | present | LOTUS | |
| 1-Hexadecene | present | LOTUS | |
| 1-Octadecene | present | LOTUS |
05DNA & barcoding44 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arum maculatum has left across the world's sequence archives.
At a glance
DNA specimens44
Marker genes5
GenBank sequences10
eDNA detections117
Countries5
The DNA barcodea real sequence read deposited for this species
CGAACCCCCCACCCACCCCACCCCCCTCACAAGGGGGACACGTGCGTGTGGGAGGGACGAGGGATGCGGAGATTGGCCCACCGTGCACCA …
Arum maculatum voucher EDNA21-0060726 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL4★ITS1★ITS2rpoB
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Arum maculatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size9 985 380 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Arum maculatum9.99 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 56 n = 28
Ploidy4× / 8× cytotypes
Chromosome records28–842n range56median56mode68records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 5651×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +10
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — BEDALOV M., POLDINI L., B., KUPFER P. - 2002. IOPB Chomosome Data 18. IN: Kirschner J., Drabkova L., Stace A. C., - IOPB Newsletter , 34: 20-21.
CCDB · ita-fl — ILLUMINATI O., SPINOSI K., BIANCHI G., MARCHI P. - 1995. Numeri cromosomici per la Flora Italiana: 1358-1371. Inform. Bot. Ital. , 27(2-3): 261-274.
CCDB · brit-fl — Maude, P.F. New Phytol. 39: 17-32 (1940)
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Marchant, C.J. Kew Bull. 26: 395-404 (1972)
CCDB · brit-fl — Sowter, F.A. J. Ecol. 37: 207-219 (1946)
CCDB · fl-europaea — Prime, 1954
CCDB · ipcn-api-dl — Bedalov, M. 1981. Cytotaxonomy of the genus Arum (Araceae) in the Balkans and the Aegean Area. Bot. Jahrb. Syst. 102: 183–200.
CCDB · ipcn-api-dl — Alpinar, K. 1986. Some observations and findings on Arum L. (Araceae) species of west Turkey. Doga, T;auurk Biyol. Dergisi (Turkish J. Biol.). 10: 240–253. (In Turkish).
CCDB · ipcn-api-dl — Alpinar, A. 1987. Chromosome Number Reports 94. Taxon 36: 285.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — D'Emerico, S., P. Bianco & P. Medagli. 1993. Chromosome numbers and karyotypes in Arum (Araceae). Caryologia 46: 161–170.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Bedalov, M. & A. Terpo. 1998. IOPB chromosome data 13. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 18.
CCDB · ipcn-api-dl — Bedalov, M. & I. Hodalova. 1998. IOPB chromosome data 13. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 17–18.
CCDB · ipcn-api-dl — Bedalov, M., C. Dragulescu & P. Küpfer. 1998. IOPB chromosome data 13. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 17.
CCDB · ipcn-api-dl — D'Emerico, S., P. Bianco, P. Medagli, M. Bedalov & F. Piccarreta. 1993. Indagini cariologiche su alcune specie di Arum L. (Araceae). Giorn. Bot. Ital. 127(3): 514.
CCDB · ipcn-api-dl — Bianco, P., S. D'Emerico, P. Medagli & M. Bedalov. 1993. Osservazioni biosistematiche su Arum apulum (Carano) Bedalov, endemismo pugliese. Giorn. Bot. Ital. 127(3): 509.
CCDB · ipcn-api-dl — Bedalov, M., V. Bronic, A. Antonietti & P. Küpfer. 2002. IOPB chromosome data 18. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 34: 18–19.
CCDB · ipcn-api-dl — Bedalov, M., L. Poldini & P. Küpfer. 2002. IOPB chromosome data 18. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 34: 20–21.
CCDB · ipcn-api-dl — Bedalov, M., J. L. Richard, A. Antonietti & P. Küpfer. 2002. IOPB chromosome data 18. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 34: 21.
CCDB · ipcn-api-dl — Bedalov, M. 2006. Investigations in the genus Arum L. in Istrai (Croatia). Webbia 61(2): 209–215.
CCDB · book-ipcn67-71 — TARNAVARSCHI, I.T., & I. LUNGEANU. 1970. Chromosomenzahlen von einigen in Rumanian wildwachsenden Anthophyten. Rev. Roum. Biol., Bot. 15: 381-383.
CCDB · book-ipcn67-71 — TARNAVSCHI, I.T . & r. LUNGEANU. 1970. In IOPB chromosome number reports XXVIII. Taxon 19: 608-610.
CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-
CCDB · book-ipcn75-78 — Beuret 1977
CCDB · book-ipcn73-74 — BEDALOV, M. 1973. In IOPB chromosome number reports XL. Taxon 22: 285-291.
CCDB · book-ipcn73-74 — TERPO, A. 1973. Kritische Revision der Arum-Arten des Karpatenbecken Acta Bot. Acad. Sci. Hung. 18: 215-255.
CCDB · book-fedorov — Lovis 1954
CCDB · book-fedorov — Prime 1954
CCDB · book-fedorov — Gadella, Kliphuis 1962:
CCDB · kew — Bennett MD, Smith JB. 1976. Nuclear DNA amounts in angiosperms. Philosophical Transactions of the Royal Society of London Series B-Biological Sciences 274: 227-274.
CCDB · Cave1963 — Gadella & Klip. 1963
CCDB · CromoCat 2015 — Alpinar, A. (1987). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XCIV]. Taxon 36(1): 285.
CCDB · CromoCat 2015 — Bedalov, M. & Gutermann, W. (1982). Die Gattung Arum in den Ostalpenländern. Stapfia 10: 95-97
CCDB · CromoCat 2015 — Bedalov, M. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XL]. Taxon 22(2/3): 285.
CCDB · CromoCat 2015 — Bedalov, M. (1998a). IOPB Chromosome Data 13 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 29: 17-18.
+8 more references
2n 2810×CCDB · poland · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +3
CCDB · poland — Wcis?o H. 1970. Karyological studies in Polish representatives of Spadiciflorae. Acta Biol. Cracov. Ser. Bot. 13, 79-88.
CCDB · poland — Benzet E. 1971. Rpartition gographique de quelques Arum des groupes Maculatum L. et Italicum Mili. Buli. Soc. Neucht. Sc. Nat. 94, 29-36.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — WCISLO, H. 1970. Karylogical studies in Polish representatives of spadiciflorae. Acta Biol. Cracov . ser. Bot. 13: 1-14.
CCDB · araceae — Alpinar, 1986
CCDB · book-fedorov — Love A., Love D. 1942L
CCDB · book-fedorov — Hagerup 191.!.4a
CCDB · book-fedorov — Hagerup (Love A., Love D. 1942b)
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Mesí?ek, J. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesícek & V. Javurková-Jarolímová. Academia, Praha NONE LISTED
2n 302×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — `opova, M. & Ž. Sekovski. 1989. Chromosome atlas of some Macedonian angiosperms. V. God. Zborn. Biol. Prir.-Mat. Fak. Univ. Kiril & Metodij 39–40: 353–365.
CCDB · CromoCat 2015 — Šopova, M. & Ž. Sekovsky. (1989). Chromosome atlas of some Macedonian angiosperms. V. Godishen Zbornik Biologija Prirodno-Matematichki Fakultet na Univerzitetot Kiril i Metodij 39-40: 353-365.
2n 322×CCDB · book-fedorov
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Delay 1947
2n 842×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · brit-fl — Maude, P.F. New Phytol. 39: 17-32 (1940)
2n 701×CCDB · brit-fl
CCDB · brit-fl — Prime, C.T., Buckle, O., Lovis, J.D. Bot. Soc. Brit. Isles Proc. 1: 287-296 (1955)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type398 677 records
Wild obs. + sensor394 764
Museum / vouchered2 460
Cultivated / captive247
Other1 206
Origin
Native27 713
Introduced817
Range
Area of Occupancy AOO293 744 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy41% within 1 km
≤100 m 70 086≤1 km 76 416≤10 km 204 700>10 km 2 687
353 889 georeferenced · 40 875 without coordinates
Open the mapobservation + sensor394 764
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy61% within 1 km
≤100 m 435≤1 km 245≤10 km 324>10 km 112
1 116 georeferenced · 1 344 without coordinates
Open the institutions mapphysical evidence2 460
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy17% within 1 km
≤1 km 1≤10 km 5
6 georeferenced · 241 without coordinates
Open the mapnot free-living247
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions54 of 113 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| DBF-NHMDlocation not on record | 371 |
| BFLlocation not on record | 353 |
| BIO-UNIPIlocation not on record | 149 |
| MeiseBGlocation not on record | 129 |
| KFGBlocation not on record | 95 |
| LDlocation not on record | 74 |
| Uniwersytet Wrocławskilocation not on record | 74 |
| Salzburg, AT | 54 |
| Görlitz, DE | 52 |
| Karlsruhe, DE | 51 |
| Bern, CH | 38 |
| GJOlocation not on record | 33 |
| Provincia di Livornolocation not on record | 30 |
| Uppsala, SE | 30 |
| South Kensington, GB | 30 |
| San Sebastián, ES | 26 |
| Oskarshamn, SE | 26 |
| Mlocation not on record | 23 |
| LfUlocation not on record | 23 |
| Adam Mickiewicz University in Poznańlocation not on record | 22 |
| SLU Artdatabankenlocation not on record | 21 |
| Paris, FR | 20 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 18 |
| Vitoria, ES | 17 |
| Chicago, US | 16 |
| Moscow State Universitylocation not on record | 15 |
| Dresden, DE | 15 |
| Pamplona, ES | 14 |
| BRNUlocation not on record | 13 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 12 |
| Berlin, DE | 12 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 11 |
| MAlocation not on record | 9 |
| Frankfurt am Main | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| Kostrzyca Forest Gene Banklocation not on record | 9 |
| Porrentruy, CH | 9 |
| Philadelphia, US | 9 |
| Frauenfeld, CH | 8 |
| Tilburg, NL | 7 |
| Fulda, DE | 6 |
| Olocation not on record | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Glarus, CH | 5 |
| Salamanca, ES | 5 |
| Barcelona, ES | 5 |
| CICYTEXlocation not on record | 4 |
| UGentlocation not on record | 4 |
| Pamplona, ES | 4 |
| Zürich, CH | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| BDBClocation not on record | 4 |
| BClocation not on record | 4 |
| WTUlocation not on record | 3 |
| St. Paul, US | 3 |
| Winterthur, CH | 3 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 3 |
| Auckland, NZ | 3 |
| Wlocation not on record | 3 |
| Vancouver, CA | 3 |
| H-Wolflocation not on record | 3 |
| H-HarzKurtlocation not on record | 3 |
| Podgorica, ME | 3 |
| SZUlocation not on record | 3 |
| KMNlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Fort Worth, US | 2 |
| Zürich, CH | 2 |
| Bronx, US | 2 |
| National Museum Waleslocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Xiamen, CN | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| No collectionlocation not on record | 2 |
| Madrid, ES | 2 |
| Bergen, NO | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| València, ES | 2 |
| Santa Barbara, US | 2 |
| SNSNMClocation not on record | 2 |
| PrivatHerblocation not on record | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Saint Louis, US | 2 |
| Davenport, US | 2 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 2 |
| US | 1 |
| Kew, GB | 1 |
| Nijmegen, NL | 1 |
| FLADlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Stockholm, SE | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Sion, CH | 1 |
| CJBGlocation not on record | 1 |
| Flagstaff, US | 1 |
| Logan, US | 1 |
| Plocation not on record | 1 |
| Herb. BBGlocation not on record | 1 |
| Christchurch, NZ | 1 |
| PRClocation not on record | 1 |
| Clemson, US | 1 |
| Bangkok, TH | 1 |
| Bourges, FR | 1 |
| Madison, US | 1 |
| RJBJCIlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Pullman, US | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| New Haven, US | 1 |
113 institutions · 2 103 of 2 460 vouchered records shown · 354 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA117 detections
Where the DNA of Arum maculatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found117
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 117 detections have coordinates
Open the map5 countries0
forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.6 °C 13.4–16.2
Seasonal swing summer↔winter18.9 °C
Max temp (day)17.9 °C 17.5–20.5
Min temp (night)10.4 °C 8.50–11.8
Precipitation53.7 mm/mo 46.9–67.1
Air humidity61.0 % 58.5–62.5
Moisture balance-24.9 mm/mo -59.9–-19.5
Vapour deficit609 Pa 588–770
Wind speed4.30 m/s 4.00–4.40
Cloud cover39.8 % 34.5–40.5
CHELSA 1981–2010, ~9 km grid, at location & month of 107 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.