Artocarpus scortechinii

King ex Hook.f. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Artocarpus

At a glance

Occurrence records84

Data sources5

Biological traits10

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Artocarpus scortechinii's data was compiled from.

GBIFGlobal Biodiversity Information Facility84 records↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources10 traits

Chemical compositionNPASS12 compounds

Occurrence & distributionGBIF84 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesGIFT

Size & morphology2

Plant height28 m

Plant height max45 m

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Habitat & environment4

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition12 compounds

Compounds documented for Artocarpus scortechinii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cembrane diterpenoids12

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,3S,4R,7R,8R,11R,12R)-3,8,11-trihydroxy-4,8,12-trimethyl-15-methylidene-13,18-dioxatricyclo[10.3.2.14,7]octadecan-14-one	present	NPASS
(1R,3S,4R,7R,8R,12R)-3,8-dihydroxy-4,8,12-trimethyl-15-methylidene-13,18-dioxatricyclo[10.3.2.14,7]octadecane-11,14-dione	present	NPASS
11-epi-Sinulariolide	present	NPASS
[(1R,3S,4R,7R,8R,11R,12R)-3,8-dihydroxy-4,8,12-trimethyl-15-methylidene-14-oxo-13,18-dioxatricyclo[10.3.2.14,7]octadecan-11-yl] acetate	present	NPASS
[(1R,3S,4R,7R,8R,11R,12R)-3-acetyloxy-8-hydroxy-4,8,12-trimethyl-15-methylidene-14-oxo-13,18-dioxatricyclo[10.3.2.14,7]octadecan-11-yl] acetate	present	NPASS
[(1R,3S,4R,7R,8R,12R)-8-hydroxy-4,8,12-trimethyl-15-methylidene-11,14-dioxo-13,18-dioxatricyclo[10.3.2.14,7]octadecan-3-yl] acetate	present	NPASS
[(1R,3S,4R,7S,8S,12R)-3-hydroxy-4,8,12-trimethyl-15-methylidene-11,14-dioxo-13,18-dioxatricyclo[10.3.2.14,8]octadecan-7-yl] acetate	present	NPASS
[(1R,3S,5S,7E,9R,12R,13R)-9-hydroxy-5,9,13-trimethyl-16-methylidene-15-oxo-4,14-dioxatricyclo[11.3.2.03,5]octadec-7-en-12-yl] acetate	present	NPASS
[(1R,3S,5S,7E,9S,12R,13R)-9-hydroxy-5,9,13-trimethyl-16-methylidene-15-oxo-4,14-dioxatricyclo[11.3.2.03,5]octadec-7-en-12-yl] acetate	present	NPASS
Dendronpholide G	present	NPASS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artocarpus scortechinii has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ917029.1 ↗668 bpSingapore

ACGT

CTGCGGAAGATCATTGTCGAAACCTGCCCAGCAGAAAGACCCGCGAACAGGTTACAACGTTCGGGGGGCGAGGGGCGCGACGCGCCTCGA …

Artocarpus scortechinii voucher NZ218 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type84 records

Wild obs. + sensor79

Museum / vouchered2

Other3

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 77

78 georeferenced · 1 without coordinates

Open the mapobservation + sensor79

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)