Artocarpus rigidus

Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Artocarpus

At a glance

Occurrence records324

Data sources8

Biological traits22

DNA specimens40

eDNA detections18

Sources8 archives

Databases and archives Artocarpus rigidus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility324 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS35 compounds

Occurrence & distributionGBIF324 records

Environmental DNA1 datasets · 1 countries18 detections

DNA & barcodingBOLD · NCBI40 specimens

01Narrative

猴面果（学名：）为桑科波羅蜜屬下的一个种，原生于中印半岛南部及马来群岛西部。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Plant height30 m

Plant height max45 m

Seed mass67 mg

Seed mass max67 mg

Seed mass min67 mg

Seed volume900 mm³

Seed volume max900 mm³

Seed volume min900 mm³

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Wood density513 mg/cm³

Wood density max550 mg/cm³

Wood density min468 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition35 compounds

Compounds documented for Artocarpus rigidus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Flavones21

Plant xanthones4

Monomeric stilbenes3

Lupane triterpenoids1

Ursane and Taraxastane triterpenoids1

Documented compounds35 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(17R)-12,21,23-trihydroxy-8,8,18,18-tetramethyl-3,9,19-trioxahexacyclo[15.6.1.02,15.04,13.05,10.020,24]tetracosa-1(24),2(15),4(13),5(10),6,11,20,22-octaen-14-one	present	LOTUS
(17R,19S,22R,24R)-17,21,21-trimethyl-4-(3-methylbut-2-enyl)-8,16,20,23-tetraoxahexacyclo[13.10.0.02,7.09,14.017,24.019,22]pentacosa-1(15),2(7),3,5,9(14),10,12-heptaene-5,11-diol	present	LOTUS
(17S)-12,21,23-trihydroxy-8,8,18,18-tetramethyl-11-(3-methylbut-2-enyl)-3,9,19-trioxahexacyclo[15.6.1.02,15.04,13.05,10.020,24]tetracosa-1(24),2(15),4,6,10,12,20,22-octaen-14-one	present	LOTUS
(17S,18S)-12,21,23-trihydroxy-8,8,18-trimethyl-18-(4-methylpent-3-enyl)-3,7,19-trioxahexacyclo[15.6.1.02,15.04,13.06,11.020,24]tetracosa-1(24),2(15),4,6(11),9,12,20,22-octaen-14-one	present	LOTUS
(1R,17R,18S)-12,20-dihydroxy-8,8-dimethyl-17-prop-1-en-2-yl-3,9,23-trioxahexacyclo[16.4.1.01,18.02,15.04,13.05,10]tricosa-2(15),4(13),5(10),6,11,20-hexaene-14,19,22-trione	present	LOTUS
(5aS)-1,3,8-Trihydroxy-5,5,11,11-tetramethyl-5a,6-dihydro-5H,7H,11H-[1]benzofuro[3,4-bc]pyrano[3,2-h]xanthen-7-one	present	LOTUS
(5R)-1,8,10-trihydroxy-2,9-bis(3-methylbut-2-enyl)-5-prop-1-en-2-yl-5,6-dihydrobenzo[c]xanthene-3,4,7-trione	present	LOTUS
(6R)-5,9,11,14-tetrahydroxy-3,3-dimethyl-10-(3-methylbut-2-enyl)-6-prop-1-en-2-yl-6,7-dihydrochromeno[7,6-c]xanthen-8-one	present	LOTUS
(6R)-5,9,11,14-tetrahydroxy-3,3-dimethyl-6-prop-1-en-2-yl-6,7-dihydrochromeno[7,6-c]xanthen-8-one	present	LOTUS

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artocarpus rigidus has left across the world's sequence archives.

At a glance

DNA specimens40

Marker genes3

GenBank sequences10

eDNA detections18

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPZ305858.1 ↗401 bpIndonesia · 2024

ACGT

GACCAAGTTGCGCCCGAGCCATCGGCCGAGGGCACGCCTGCCTGGGCGTCACACACCGTCGCCCCCCCAACTCCCTTTGACACCATCCAC …

Artocarpus rigidus voucher MT01 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK7★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type324 records

Wild obs. + sensor53

Museum / vouchered246

Other25

Origin

Native1

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 3≤1 km 39>10 km 3

45 georeferenced · 8 without coordinates

Open the mapobservation + sensor53

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1>10 km 3

4 georeferenced · 242 without coordinates

Open the institutions mapphysical evidence246

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cibinong Science Center, Herbarium Bogorienselocation not on record	26
Bronx, US	5
Moscow State Universitylocation not on record	3
University of Hamburglocation not on record	2
Taipei, TW	1
Taipei, TW	1
Taipei, TW	1
Edinburgh, GB	1

8 institutions · 40 of 246 vouchered records shown · 206 without an institution code

09Environmental DNA18 detections

Where the DNA of Artocarpus rigidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 26.1–26.6

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 29.5–30.0

Min temp (night)22.6 °C 22.6–23.0

Precipitation269 mm/mo 243–269

Air humidity68.1 % 66.4–68.1

Moisture balance133 mm/mo 102–133

Vapour deficit1,080 Pa 1,080–1,173

Wind speed1.20 m/s 1.20–1.40

Cloud cover57.6 % 54.2–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)