Artocarpus lacucha

Buch.-Ham. ex D.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Artocarpus

At a glance

Occurrence records258

Data sources12

Biological traits28

DNA specimens40

eDNA detections25

Sources12 archives

Databases and archives Artocarpus lacucha's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility258 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS · NPASS52 compounds

Occurrence & distributionGBIF258 records

Environmental DNA1 datasets · 4 countries25 detections

DNA & barcodingBOLD · NCBI40 specimens

Genome at a glanceCCDB2n = 56

01Narrative

Artocarpus dadah is a tree species in the genus Artocarpus found in Myanmar to W. Malesia including Sumatra. It is of pacific origin and is a species of the Mulberry family, Moraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology8

Plant height17.5 m

Plant height max24 m

Seed mass378 mg

Seed mass max379 mg

Seed mass min377 mg

Seed volume213 mm³

Seed volume max300 mm³

Seed volume min110 mm³

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio18.84 g/g

Leaf c371 mg/g

Leaf n17.97 mg/g

Leaf p1.55 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)11.22 mm²/mg

Wood density640 mg/cm³

Other traits1

Plant support typefree-standing

03Chemical composition52 compounds

Compounds documented for Artocarpus lacucha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Oleanane triterpenoids11

Monomeric stilbenes10

Flavan-3-ols7

2-arylbenzofurans4

Chalcones4

Documented compounds52 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Epiafzelechin	present	LOTUS
(2R)-2-(2,4-dihydroxyphenyl)-5,7-dihydroxy-2,3-dihydrochromen-4-one	present	LOTUS
(2R,3R,4R,5R,6S)-2-[[(2R,3S)-5,7-dihydroxy-2-(4-hydroxyphenyl)-3,4-dihydro-2H-chromen-3-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS
(2S)-2-(2,4-dihydroxyphenyl)-3,4-dihydro-2H-chromene-5,7-diol	present	LOTUS
(2S)-5,7,2',4'-tetrahydroxyflavanone	present	LOTUS
(2S,3R)-2-(2,4-dihydroxyphenyl)-3,5,7-trihydroxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S,3R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-3-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2,3-dihydrochromen-4-one	present	LOTUS
(2S,3R,4R,5R,6S)-2-[[(2R,3R)-5,7-dihydroxy-2-(4-hydroxyphenyl)-3,4-dihydro-2H-chromen-3-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3S)-2-(3,4-dihydroxyphenyl)-8-[(2R,3R,4R)-3,5,7-trihydroxy-2-(4-hydroxyphenyl)-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,5,7-triol	present	LOTUS
(2S,3S,4R,5R,6R)-2-[[(2R,3S)-5,7-dihydroxy-2-(4-hydroxyphenyl)-3,4-dihydro-2H-chromen-3-yl]oxy]-6-methyloxane-3,4,5-triol	present	LOTUS

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artocarpus lacucha has left across the world's sequence archives.

At a glance

DNA specimens40

Marker genes6

GenBank sequences10

eDNA detections25

Countries7

The DNA barcodea real sequence read deposited for this species

ITSMK850228.1 ↗602 bpThailand · 2016

ACGT

GACCCGCGAACACGTTACAACACTTGGGGGGCGAGGGGTGCCATGCGCCTTGATTCCCCCATGCCGAGTGCGTGTGGCTTTGGCACGCGT …

Artocarpus lacucha voucher PBM05214 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL1★rbcLa★ITS9★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Artocarpus lacucha carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidydiploid inferred

Chromosome records28–562n range56median56mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 562×CCDB · book-indian_vol1 · CCDB · book-atlas-flowering-plants

CCDB · book-indian_vol1 — Banerji, I. & Hakim, A. 1954 ; Hans, A.S. 1972 ; Mehra, P.N. & Hans, A.S. 1972; Mehra, P.N. & Gill, B.S. 1974

CCDB · book-atlas-flowering-plants — Banerji & H. 1954

2n 281×CCDB · book-ipcn75-78

CCDB · book-ipcn75-78 — Mehr a & Gill 1974

n 283×CCDB · book-ipcn72 · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74

CCDB · book-ipcn72 — HANS, A.S. 1972. Cytomorphology of arborescent Moraceae. J. Arnold Arbor. 53: 216-225.

CCDB · book-ipcn75-78 — Mehra 1976

CCDB · book-ipcn73-74 — MEHRA, P.N., & A.S. HANS. 1972. Comparison of diploid and natural polyploid hardwoods. J. Indian Bot. soc. 51: 319-325.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type258 records

Wild obs. + sensor104

Museum / vouchered67

Other87

Range

Area of Occupancy AOO704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 31≤1 km 12≤10 km 4>10 km 5

52 georeferenced · 52 without coordinates

Open the mapobservation + sensor104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 67 records without

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	22
Cibinong Science Center, Herbarium Bogorienselocation not on record	11
Government College University Lahore, Dr. Sultan Ahmad Herbariumlocation not on record	3
South Kensington, GB	2
BISHlocation not on record	2
Saint Louis, US	1
Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
LDlocation not on record	1
Gujarat Biodiversity Gene Banklocation not on record	1

10 institutions · 45 of 67 vouchered records shown · 17 without an institution code

09Environmental DNA25 detections

Where the DNA of Artocarpus lacucha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found25

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 25 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.8 °C 18.2–26.3

Seasonal swing summer↔winter1.80 °C

Max temp (day)25.6 °C 25.4–29.7

Min temp (night)20.7 °C 12.2–22.7

Precipitation269 mm/mo 9.00–341

Air humidity68.1 % 51.6–74.2

Moisture balance133 mm/mo -66.4–252

Vapour deficit1,007 Pa 715–1,173

Wind speed2.00 m/s 1.20–2.10

Cloud cover49.9 % 26.4–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)