Artocarpus integer

(Thunb.) Merr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Artocarpus

At a glance

Occurrence records426

Data sources13

Biological traits32

DNA specimens52

eDNA detections43

Sources13 archives

Databases and archives Artocarpus integer's data was compiled from.

WikipediaWikimedia Foundation14 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility426 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI43 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics52 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Chemical compositionLOTUS · NPASS106 compounds

Occurrence & distributionGBIF426 records

Environmental DNA1 datasets · 2 countries43 detections

DNA & barcodingBOLD · NCBI52 specimens

Genome at a glanceCCDB2n = 56

01Narrative

Artocarpus integer, commonly known as chempedak or cempedak, is a species of tree in the family Moraceae in the same genus as breadfruit and jackfruit. It is native to Southeast Asia. Cempedak is an important crop in Malaysia and is also popularly cultivated in southern Thailand and parts of Indonesia, and has the potential to be utilized in other areas. Cempedak is currently limited in range to Southeast Asia, with some trees in Australia and Hawaii.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Leaf length131 mm

Leaf width70 mm

Plant height20 m

Plant height max24 m

Seed length27.9 mm

Seed mass6 944 mg

Seed mass max8 333 mg

Seed mass min5 555 mg

Seed volume8 700 mm³

Seed volume max8 700 mm³

Seed volume min8 700 mm³

Seed width max19.5 mm

Life cycle & reproduction4

Deciduousnessevergreen

Life formtree

Life spanperennial

Pollination syndrome detailedinsect

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio22.71 g/g

Leaf c495 mg/g

Leaf n21.92 mg/g

Leaf p1.6 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)10.19 mm²/mg

Wood density551 mg/cm³

Other traits2

Leaf thickness0.032 mm

Seed height max16.2 mm

03Chemical composition106 compounds

Compounds documented for Artocarpus integer across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Flavones62

Flavanones9

Monomeric stilbenes5

Chalcones5

Cycloartane triterpenoids4

Documented compounds106 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Ursolic Acid	present	LOTUS
(10R)-22-[(2E)-3,7-dimethylocta-2,6-dienyl]-5,7,8,15-tetrahydroxy-19,19-dimethyl-10-prop-1-en-2-yl-2,20-dioxapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(14),3(12),4(9),5,7,15,17,21-octaen-13-one	present	LOTUS
(10S)-22-[(2E)-3,7-dimethylocta-2,6-dienyl]-5,7,8,15-tetrahydroxy-19,19-dimethyl-10-prop-1-en-2-yl-2,20-dioxapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(14),3(12),4(9),5,7,15,17,21-octaen-13-one	present	LOTUS
(10S)-5,7,8,15-tetrahydroxy-19,19-dimethyl-22-(3-methylbut-2-enyl)-10-prop-1-en-2-yl-2,20-dioxapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(14),3(12),4(9),5,7,15,17,21-octaen-13-one	present	LOTUS
(11R)-6,7,15-trihydroxy-19,19-dimethyl-11-(2-methylprop-1-enyl)-2,10,20-trioxapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(22),3(12),4,6,8,14,16(21),17-octaen-13-one	present	LOTUS
(11R)-6,7,15-trihydroxy-19,19-dimethyl-22-(3-methylbut-2-enyl)-11-(2-methylprop-1-enyl)-2,10,20-trioxapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(14),3(12),4,6,8,15,17,21-octaen-13-one	present	LOTUS
(11S)-6,7,15-trihydroxy-19,19-dimethyl-22-(3-methylbut-2-enyl)-11-(2-methylprop-1-enyl)-2,10,20-trioxapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(14),3(12),4,6,8,15,17,21-octaen-13-one	present	LOTUS
(13R)-6,8,17,19-tetrahydroxy-14,14-dimethyl-5-(3-methylbut-2-enyl)-3,15-dioxapentacyclo[11.6.1.02,11.04,9.016,20]icosa-1(20),2(11),4,6,8,16,18-heptaen-10-one	present	LOTUS
(13S)-8,19-dihydroxy-6,17-dimethoxy-14,14-dimethyl-3,15-dioxapentacyclo[11.6.1.02,11.04,9.016,20]icosa-1(20),2(11),4,6,8,16,18-heptaen-10-one	present	LOTUS
(17R)-12,21,23-trihydroxy-8,8,18,18-tetramethyl-5-(3-methylbut-2-enyl)-3,7,19-trioxahexacyclo[15.6.1.02,15.04,13.06,11.020,24]tetracosa-1(24),2(15),4(13),5,9,11,20,22-octaen-14-one	present	LOTUS

05DNA & barcoding52 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artocarpus integer has left across the world's sequence archives.

At a glance

DNA specimens52

Marker genes3

GenBank sequences10

eDNA detections43

Countries4

The DNA barcodea real sequence read deposited for this species

rbcLLC736099.1 ↗432 bpMalaysia

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAATATGAAGTCAAAGATACT …

Artocarpus integer 1819108 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★rbcL5★ITS

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Artocarpus integer carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidydiploid inferred

Chromosome records56–562n range56median56mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 5610×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov +2

CCDB · ipcn-api-dl — Oginuma, K. & H. Tobe. 1995. Karyomorphology of some Moraceae and Cecropiaceae (Urticales). J. Pl. Res. 108: 313–326.

CCDB · book-indian_vol1 — Janaki Ammal, E.K. (D. 1945 :; Nanda, P.C. 1962

CCDB · book-indian_vol1 — Le Coq, C. 1963

CCDB · book-fedorov — Janaki Ammal

CCDB · book-fedorov — D. 1945)

CCDB · book-fedorov — Nanda 1962

CCDB · book-fedorov — LeCoq 1963

CCDB · book-fedorov — Banerji L.. Hakim 1954

CCDB · book-atlas-flowering-plants — EKJ*

CCDB · Cave1963 — LeCoq 1963

n 281×CCDB · Cave1962

CCDB · Cave1962 — Nanda 1962

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type426 records

Wild obs. + sensor152

Museum / vouchered228

Cultivated / captive44

Other2

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 18≤1 km 113≤10 km 4>10 km 6

141 georeferenced · 11 without coordinates

Open the mapobservation + sensor152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤100 m 3≤1 km 3≤10 km 3

9 georeferenced · 219 without coordinates

Open the institutions mapphysical evidence228

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 20

20 georeferenced · 24 without coordinates

Open the mapnot free-living44

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	30
Cibinong Science Center, Herbarium Bogorienselocation not on record	16
ASUlocation not on record	5
Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record	4
Beijing, CN	3
Bronx, US	3
Xiamen, CN	3
Peking Universitylocation not on record	1
Guangzhou, CN	1
Shanghai, CN	1
Universidad de Caldas (UCaldas)location not on record	1
Tampa, US	1
St. Paul, US	1
Gujarat Biodiversity Gene Banklocation not on record	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
Edinburgh, GB	1
University of Hamburglocation not on record	1
Saint Louis, US	1
Servico de Microbiologia e Imunologialocation not on record	1
Santiago de Cali, CO	1
UNEMATlocation not on record	1

21 institutions · 78 of 228 vouchered records shown · 150 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA43 detections

Where the DNA of Artocarpus integer was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found43

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 43 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 18.2–26.1

Seasonal swing summer↔winter1.10 °C

Max temp (day)29.5 °C 25.6–29.5

Min temp (night)22.6 °C 12.2–22.6

Precipitation269 mm/mo 9.00–269

Air humidity68.1 % 51.6–68.1

Moisture balance133 mm/mo -66.4–133

Vapour deficit1,080 Pa 1,007–1,080

Wind speed1.20 m/s 1.20–2.00

Cloud cover57.6 % 26.4–57.6

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)