Artocarpus elasticus

Reinw. ex Blume · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Moraceae/Artocarpus

At a glance

Occurrence records408

Data sources11

Biological traits32

DNA specimens20

eDNA detections13

Sources11 archives

Databases and archives Artocarpus elasticus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility408 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources32 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF408 records

Environmental DNA2 datasets · 2 countries13 detections

DNA & barcodingBOLD · NCBI20 specimens

Genome at a glanceCCDB2n = 56

01Narrative

Pokok Terap Hitam merupakan sejenis tumbuhan yang terdapat di hutan Malaysia serta di negara-negara ASEAN yang lain. Nama saintifiknya Artocarpus scortechinii King.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Leaf length728 mm

Leaf width550 mm

Plant height45 m

⚠ sources differ — GIFT: 45 m · TRY: 3.2 m

Plant height max45 m

Seed length11.8 mm

Seed mass150 mg

Seed mass max150 mg

Seed mass min150 mg

Seed volume565 mm³

Seed volume max590 mm³

Seed volume min540 mm³

Seed width max10.3 mm

Life cycle & reproduction3

Deciduousnessevergreen

Life formtree

Life spanperennial

Habitat & environment6

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessfleshy

Growth formtree

Woodinesswoody

Physiology & chemistry9

Leaf C:N ratio28.17 g/g

Leaf c457 mg/g

Leaf n16.74 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)8.06 mm²/mg

Wood density385 mg/cm³

⚠ sources differ — TRY: 385 mg/cm³ · GIFT: 363 mg/cm³

Wood density max380 mg/cm³

Wood density min350 mg/cm³

Other traits2

Leaf thickness0.022 mm

Seed height max7.8 mm

03Chemical composition15 compounds

Compounds documented for Artocarpus elasticus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile3 classes

Flavones11

Plant xanthones2

Carotenoids (C40, β-β)1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(11R)-6,7,15-trihydroxy-19,19-dimethyl-11-(2-methylprop-1-enyl)-2,10,20-trioxapentacyclo[12.8.0.03,12.04,9.016,21]docosa-1(22),3(12),4,6,8,14,16(21),17-octaen-13-one	present	LOTUS
(17R)-12,21,23-trihydroxy-8,8,18,18-tetramethyl-3,9,19-trioxahexacyclo[15.6.1.02,15.04,13.05,10.020,24]tetracosa-1(24),2(15),4(13),5(10),6,11,20,22-octaen-14-one	present	LOTUS
(9S)-6-hydroxy-3,3-dimethyl-9-prop-1-en-2-yl-9,10-dihydro-8H-pyrano[2,3-c]xanthene-7,11-dione	present	LOTUS
Artelastoxanthone	present	NPASS
Artobiloxanthone	present	LOTUS
Artoindonesianin C	present	LOTUS
Artonin E	present	LOTUS
artonol A	present	LOTUS
CID 21672553	present	LOTUS
Cycloartobiloxanthone	present	LOTUS

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artocarpus elasticus has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes6

GenBank sequences10

eDNA detections13

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLLC736104.1 ↗432 bpMalaysia

ACGT

ACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTACACTCCTGAATATGAAGTCAAAGATACG …

Artocarpus elasticus 1213134.1 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK6★rbcL4★rbcLa★ITS★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Artocarpus elasticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 56 n = 28

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 561×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Oginuma, K. & H. Tobe. 1995. Karyomorphology of some Moraceae and Cecropiaceae (Urticales). J. Pl. Res. 108: 313–326.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type408 records

Wild obs. + sensor120

Museum / vouchered275

Other13

Origin

Native13

Range

Area of Occupancy AOO784 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 52≤1 km 23≤10 km 2>10 km 4

81 georeferenced · 39 without coordinates

Open the mapobservation + sensor120

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 270 without coordinates

Open the institutions mapphysical evidence275

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cibinong Science Center, Herbarium Bogorienselocation not on record	11
Paris, FR	4
ASUlocation not on record	4
Xiamen, CN	3
Bronx, US	2
Kew, GB	2
Moscow State Universitylocation not on record	1
Davis, US	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1
Burlington, US	1
Edinburgh, GB	1
Guangzhou, CN	1

13 institutions · 33 of 275 vouchered records shown · 242 without an institution code

09Environmental DNA13 detections

Where the DNA of Artocarpus elasticus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.1 °C 22.7–26.7

Seasonal swing summer↔winter1.30 °C

Max temp (day)29.5 °C 25.7–30.0

Min temp (night)22.6 °C 18.9–23.3

Precipitation269 mm/mo 234–288

Air humidity68.1 % 66.2–70.0

Moisture balance133 mm/mo

Vapour deficit1,080 Pa 825–1,184

Wind speed1.20 m/s

Cloud cover55.9 % 39.0–59.2

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)