Arthropteris tenella

(G.Forst.) J.Sm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Tectariaceae/Arthropteris

At a glance

Occurrence records782

Data sources7

Biological traits21

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Arthropteris tenella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility782 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources21 traits

Occurrence & distributionGBIF782 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 84

01Narrative

Arthropteris tenella is a rainforest fern of the genus Arthropteris native to eastern Australia and New Zealand. It is found in shady areas on rocks or on trees. The specific epithet tenella is from the Latin, meaning "delicate".Les Robinson - Field Guide to the Native Plants of Sydney, page 309

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology8

Leaf length185 mm

Leaf length max450 mm

Leaf length min250 mm

Leaf mass13 mg

Leaf mass per area41.32 g/m2

Leaf size325 mm²

Leaf width11.7 mm

Plant height0.1 m

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formfern

⚠ sources differ — AusTraits: fern · TRY: Fern or fern ally

Leaf compoundnesscompound

Leaf shapenarrowly_elliptical

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)24.22 mm²/mg

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arthropteris tenella has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLKT626668.1 ↗970 bpNew Zealand · 2006

ACGT

AAACCAAAGATACCGATATCTTAGCAGCATTTCGAATGACCCCACAACCTGGAGTACCGGCTGAGGAAGCCGGAGCTGCGGTAGCTGCAG …

Arthropteris tenella voucher CHR:552984 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Arthropteris tenella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 84 n = 42

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 841×CCDB · new-zealand

CCDB · new-zealand

08Occurrence & distribution

Record type782 records

Wild obs. + sensor755

Museum / vouchered27

Range

Area of Occupancy AOO1 508 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 433≤1 km 129≤10 km 46>10 km 16

624 georeferenced · 131 without coordinates

Open the mapobservation + sensor755

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤1 km 3≤10 km 6>10 km 1

10 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence27

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	7
Wuzhou, CN	4
LDlocation not on record	4
Provincia di Livornolocation not on record	2
WTUlocation not on record	1
Philadelphia, US	1
Moscow State Universitylocation not on record	1
Beijing, CN	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Minia, EG	1
HAWlocation not on record	1
South Kensington, GB	1
Honolulu, US	1
Burlington, US	1

14 institutions · 27 of 27 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)