Arthraxon hispidus
(Thunb.) Makino · speciesAt a glance
Occurrence records19 286
Data sources12
Biological traits38
DNA specimens26
eDNA detections15
Sources12 archives
Databases and archives Arthraxon hispidus's data was compiled from.
WikipediaWikimedia Foundation6 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility19 286 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources38 traits
Chemical compositionLOTUS · NPASS8 compounds
Occurrence & distributionGBIF19 286 records
Environmental DNA1 datasets · 2 countries15 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB2n = 36
01Narrative
Arthraxon hispidus, is a grass commonly known as small carpetgrass or hairy jointgrass. It is native to East Asia and was accidentally introduced to the United States, where it is considered an Invasive species.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPAusTraitsTRYGIFT
Size & morphology11
Fruit length4.25 mm
Leaf length40 mm
Leaf size378 mm²
Leaf width11 mm
Plant height0.875 m
Plant height max2 m
Plant height min0.2 m
Seed length4.25 mm
Seed mass0.112 mg
⚠ sources differ — TRY: 0.112 mg · AusTraits: 0.255 mg · GIFT: 0.11 mg
Seed mass max0.11 mg
Seed mass min0.11 mg
Life cycle & reproduction11
DeciduousnessN
Dispersal typewind
Flowering endSep
Flowering startJul
Flowering timeyyyyynnnnnny
Life formannual or perennial
Life spanperennial
⚠ sources differ — AusTraits: perennial · GIFT: annual
Pollination syndromewind
Raunkiær life formtherophyte
Resprouting capacityfire_killed
Sex typeandromonoecious
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max3 100 m
Elevation mean2 100 m
Elevation min500 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: tussock · TRY: Herb
Habitat GIFTmeadows: wet
Leaf compoundnesssimple
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC4
03Chemical composition8 compounds
Compounds documented for Arthraxon hispidus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile4 classes
Dicarboxylic acids2
Flavones2
Simple phenolic acids1
Neutral glycosphingolipids1
Documented compounds8 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R)-N-[(Z,2R,3S,4R)-3,4-dihydroxy-1-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoctadec-8-en-2-yl]-2-hydroxytetracosanamide | present | NPASS | |
| (E)-Aconitic acid | present | NPASS | |
| 2-(3,4-dihydroxyphenyl)-5-hydroxy-7-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| cis-aconitate | present | NPASS | |
| GGGUGZHBAOMSFJ-CJWXVCQESA-N | present | NPASS | |
| Helicide | present | NPASS | |
| Luteolin 7-diglucoside | present | LOTUS | |
| VWYANPOOORUCFJ-JFDHFCOYSA-N | present | NPASS |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arthraxon hispidus has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes5
GenBank sequences10
eDNA detections15
Countries4
The DNA barcodea real sequence read deposited for this species
ATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCGAGGCCTTTTGGTTGAGGGCACGTC …
Arthraxon hispidus voucher DWQGZ789 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL5★ITS4★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Arthraxon hispidus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidypolyploid inferred
Chromosome records10–402n range36median36mode19records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3614×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +4
CCDB · iapt — IAPT/IOPB Chromosome Data 8
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1981. Kariologicheskoe issledovanie sosudistykh rastenij ostrovov Dal'nevostocnogo gosudarstvennogo morskogo sapovednika. Sb. Cvetkaye Rastenija Ostrovov Dalnevostochnogo Morskogo Sapovednika. 92–114.
CCDB · ipcn-api-dl — Morton, J. K. 1993. Chromosome numbers and polyploidy in the flora of Cameroon Mountain. Opera Bot. 121: 159–172.
CCDB · book-ipcn66 — Gould 1966
CCDB · book-ipcn67-71 — GOULD, F.W., & T.R. SODERSTROM. 1970. Chromosome numbers of some Mexican and Colombian grasses. Canad. J. Bot. 48: 1633-1639.
CCDB · book-ipcn67-71 — POHL, R.W., & G. DAVIDSE. 1971. Chromosome numbers of Costa Rican grasses. Brittonia 23: 293-324.
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Tateoka, T. 1953, 1954 ; Celarier, R.P. 1957a ; Chen, C.C. & Hsu, C.C. 1962; Mehra, P. N. & Sharma, M.L. 1975a
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov) ; Delay, C. 1947 .
CCDB · book-indian_vol2 — Mehra, P.N. & Sharma, M.L. 1972, 1975a
CCDB · book-indian_vol2 — Gould, F.W. 1966; Gould, F.W. & Soderstrom, T.R. 1970 ; Pohl, R.W. & Davidse, G. 1971 ; Mehra, P.N. & Sharma, M.L. 1975a ; Christopher, J. 1978 ; Dujardin, M. 1979b
CCDB · book-atlas-flowering-plants — Avdulov 1931
CCDB · book-atlas-flowering-plants — Tateoka 1954
CCDB · Cave1957 — Oelarier o
2n 403×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Avdulov, N.P. (Fedorov)
CCDB · book-indian_vol2 — Sindhe, A.N~R~-1967
2n 101×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Sindhe, A.N.R. et al. 1975
2n 381×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Bir, S.S., Gill, B.S. et al. 1979
n 189×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · Cave1957 +1
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · ipcn-api-dl — DUJARDIN, M. 1979a. In IOPB chromosome number reports LXIII. Taxon 28: 275–276.
CCDB · book-ipcn75-78 — Mehra & Sharma 1975
CCDB · book-ipcn75-78 — Kalia 1978
CCDB · book-ipcn75-78 — Christopher 1978
CCDB · Cave1957 — Oelarier o
CCDB · Cave1962 — Chen & Hsu 1962
n 92×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 12
n 192×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir, V. K. Singhal & Y. S. Bedi. 1980. Cytological studies on some grasses from Pachmarhi forest (Central India). J. Cytol. Genet. 15: 51–57.
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir, V. K. Singhal & Y. S. Bedi. 1980. Cytological studies on some grasses from Pachmarhi forests (Central India). J. Cytol. Genet. 15: 51–57.
n 151×CCDB · iapt
CCDB · iapt — IAPT/IOPB Chromosome Data 31
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type19 286 records
Wild obs. + sensor15 773
Museum / vouchered3 393
Cultivated / captive5
Other115
Origin
Native52
Introduced43
Range
Area of Occupancy AOO16 392 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy98% within 1 km
≤100 m 14 322≤1 km 235≤10 km 94>10 km 146
14 797 georeferenced · 976 without coordinates
Open the mapobservation + sensor15 773
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 123≤1 km 134≤10 km 332>10 km 70
659 georeferenced · 2 734 without coordinates
Open the institutions mapphysical evidence3 393
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 1
1 georeferenced · 4 without coordinates
Open the mapnot free-living5
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions121 of 220 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Sanda, JP | 260 |
| Odawara, JP | 214 |
| Chiba, JP | 127 |
| Beijing, CN | 126 |
| Taipei, TW | 114 |
| Tokushima, JP | 105 |
| Saint Louis, US | 79 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 68 |
| Toyama, JP | 68 |
| Shinshu Universitylocation not on record | 65 |
| Bando, JP | 63 |
| Kochi, JP | 63 |
| Canberra, AU | 59 |
| Nagano City, JP | 57 |
| Guangzhou, CN | 55 |
| National Biodiversity Institute, Costa Ricalocation not on record | 54 |
| Nagatoro-machi, Chichibu-gun, JP | 54 |
| Chengdu, CN | 51 |
| Brisbane, AU | 50 |
| Nanjing, CN | 48 |
| Philadelphia, US | 48 |
| University of Stellenboschlocation not on record | 46 |
| Tomioka, JP | 45 |
| Bangkok, TH | 40 |
| Chongqing Museumlocation not on record | 39 |
| Mount Annan, AU | 37 |
| Seoul, KR | 35 |
| Fukushima Universitylocation not on record | 33 |
| Mexico City, MX | 33 |
| Akita Prefectural Museumlocation not on record | 28 |
| College Park, US | 27 |
| Bronx, US | 27 |
| Kagoshima, JP | 26 |
| Moscow State Universitylocation not on record | 25 |
| Kunming, CN | 24 |
| KURAlocation not on record | 24 |
| Kawasaki Shi Tama Ku, JP | 23 |
| Knoxville, US | 23 |
| Sendai, JP | 22 |
| SIHUlocation not on record | 20 |
| Wuzhou, CN | 20 |
| Yangling, CN | 20 |
| National Institute of Biological Resourceslocation not on record | 18 |
| Baroda, IN | 18 |
| Kew, GB | 17 |
| TAIElocation not on record | 17 |
| Iwate Prefectural Museumlocation not on record | 16 |
| Guilin, CN | 15 |
| Xiamen, CN | 15 |
| Sagamihara, JP | 15 |
| KOMlocation not on record | 15 |
| Williamsburg, US | 15 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 15 |
| Columbia, US | 14 |
| JP | 14 |
| CASlocation not on record | 14 |
| Chapel Hill, US | 13 |
| NSMKlocation not on record | 13 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 12 |
| California Academy of Scienceslocation not on record | 12 |
| Antiguo Cuscatlán, SV | 12 |
| Museo Entomologico de Leonlocation not on record | 12 |
| Osaka, JP | 11 |
| Norfolk, US | 10 |
| Yunnan Universitylocation not on record | 10 |
| Hunan Hupingshan National Nature Reservelocation not on record | 10 |
| Zhengzhou, CN | 10 |
| Tianjin Natural History Museumlocation not on record | 10 |
| Chengdu, CN | 10 |
| Durango, MX | 9 |
| Philadelphia, US | 9 |
| Morgantown, US | 9 |
| Parthenon Tama History Museumlocation not on record | 9 |
| J.F.Oberlin Universitylocation not on record | 9 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 8 |
| Adelaide, AU | 8 |
| Taipei, TW | 8 |
| Hangzhou, CN | 8 |
| Uniwersytet Jagiellońskilocation not on record | 8 |
| Berlin, DE | 8 |
| Edinburgh, GB | 7 |
| Fayetteville, US | 7 |
| Kyoto Universitylocation not on record | 7 |
| Zhejiang Universitylocation not on record | 7 |
| MeiseBGlocation not on record | 7 |
| Fort Worth, US | 7 |
| Little Rock, US | 7 |
| University of Tennessee at Chattanoogalocation not on record | 7 |
| Jackson, US | 7 |
| South Kensington, GB | 7 |
| Shanghai, CN | 7 |
| Omachi Alpine Museumlocation not on record | 7 |
| San José, CR | 7 |
| Palmerston, AU | 7 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 6 |
| Stockholm, SE | 6 |
| Nanchong, CN | 6 |
| KIRMlocation not on record | 6 |
| Ann Arbor, US | 6 |
| GAlocation not on record | 6 |
| Wuhan, CN | 6 |
| Burlington, US | 6 |
| Millersville, US | 6 |
| Ishikawa Museum of Natural Historylocation not on record | 6 |
| Awka, NG | 5 |
| WAGlocation not on record | 5 |
| Dover, US | 5 |
| ENTClocation not on record | 5 |
| Central China Normal Universitylocation not on record | 5 |
| Elocation not on record | 5 |
| Tuscaloosa, US | 5 |
| Nagasaki University - Fisherieslocation not on record | 5 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 5 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 5 |
| Armidale, AU | 5 |
| DMZ botanic gardenlocation not on record | 5 |
| KIWElocation not on record | 4 |
| Tennessee Technological Universitylocation not on record | 4 |
| Taipei, TW | 4 |
| Asheville, US | 4 |
| US | 4 |
| Jiangxi College of Educationlocation not on record | 4 |
| Honolulu, US | 4 |
| Otaru, JP | 4 |
| Bloomington, US | 4 |
| Tlalnepantla, MX | 4 |
| Xining, CN | 4 |
| Changsha, CN | 4 |
| Tampa, US | 3 |
| Toyota city nature sanctuarylocation not on record | 3 |
| DNSMlocation not on record | 3 |
| Richmond, US | 3 |
| Hobart, AU | 3 |
| Austin, US | 3 |
| Beijing, CN | 3 |
| BClocation not on record | 3 |
| Urumqi, CN | 3 |
| Guangzhou, CN | 3 |
| Riverside, US | 3 |
| Auckland, NZ | 3 |
| nlocation not on record | 3 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 3 |
| Johnson City, US | 3 |
| GMBAlocation not on record | 2 |
| Pittsburg, US | 2 |
| Peking Universitylocation not on record | 2 |
| Minia, EG | 2 |
| Shanghai, CN | 2 |
| Fujian Institute of Subtropical Botanylocation not on record | 2 |
| KMCClocation not on record | 2 |
| Nanjing, CN | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| Jishou Universitylocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Clemson, US | 2 |
| San Angelo, US | 2 |
| Provo, US | 2 |
| 云南省思茅市民族传统医药研究所location not on record | 2 |
| IPA/SPlocation not on record | 2 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 1 |
| Tall Timbers Research Stationlocation not on record | 1 |
| AUAlocation not on record | 1 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| MAlocation not on record | 1 |
| Escuela Agrícola Panamericanalocation not on record | 1 |
| MEXUlocation not on record | 1 |
| LINUlocation not on record | 1 |
| Universidad de El Salvadorlocation not on record | 1 |
| New Brunswick, US | 1 |
| FTlocation not on record | 1 |
| Department of National Parks, Wildlife and Plant Conservationlocation not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| Plocation not on record | 1 |
| Miami, US | 1 |
| Limbe Botanical & Zoological Gardenslocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Guatemala City, GT | 1 |
| Wlocation not on record | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Xian, CN | 1 |
| EAlocation not on record | 1 |
| Vancouver, CA | 1 |
| PORTlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| West Virginia Wesleyan Collegelocation not on record | 1 |
| University of Oxfordlocation not on record | 1 |
| Görlitz, DE | 1 |
| Zapopan, MX | 1 |
| Durham, US | 1 |
| Jiangxi College of Traditional Chinese Medicinelocation not on record | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| Museo de Historia Natural de El Salvadorlocation not on record | 1 |
| Wuhan, CN | 1 |
| LDlocation not on record | 1 |
| Edmonton, CA | 1 |
| SJNAlocation not on record | 1 |
| Mexico City, MX | 1 |
| Chapingo, MX | 1 |
| Forest Herbarium Ibadan (FHI)location not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Cincinnati, US | 1 |
| Christchurch, NZ | 1 |
| Claremont, US | 1 |
| Loja, EC | 1 |
| Tapachula, MX | 1 |
| Conway, US | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| León, NI | 1 |
| Nishihara, JP | 1 |
| Ciudad de México, MX | 1 |
| Smithfield, AU | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| OTSlocation not on record | 1 |
| Queen Sirikit Botanic Garden, The Botanical Garden Organizationlocation not on record | 1 |
220 institutions · 3 307 of 3 393 vouchered records shown · 80 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Arthraxon hispidus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map2 countries0
Grassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.6 °C 12.6–25.7
Seasonal swing summer↔winter27.3 °C
Max temp (day)16.4 °C 16.4–28.3
Min temp (night)7.40 °C 7.40–21.8
Precipitation112 mm/mo 112–348
Air humidity58.0 % 58.0–67.0
Moisture balance21.7 mm/mo 21.7–212
Vapour deficit690 Pa 690–1,048
Wind speed2.90 m/s 2.50–2.90
Cloud cover41.1 % 41.1–48.4
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.