Artemisia yunnanensis — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records54

Data sources3

Biological traits6

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Artemisia yunnanensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility54 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF54 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesGIFT

Habitat & environment6

Climberself-supporting

Elevation max3 700 m

Elevation mean3 700 m

Elevation min2 400 m

Growth formherb

Woodinessnon-woody

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia yunnanensis has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ878126.1 ↗732 bpChina · 2018

ACGT

CTGACGGAGGGATCTTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTAAAAACAACCGAGCGTCGGTTGGACCAAGCGCTTGTT …

Artemisia yunnanensis voucher L. Wang et al. 2518 (IBSC) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type54 records

Wild obs. + sensor1

Museum / vouchered53

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 53 records without

Open the institutions mapphysical evidence53

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	14
Xining, CN	10
Chengdu, CN	9
Kunming, CN	5
Guangzhou, CN	5
Yangling, CN	3
Cambridge, US	2
WNNUlocation not on record	2
CASlocation not on record	1
Yunnan Universitylocation not on record	1
Edinburgh, GB	1

11 institutions · 53 of 53 vouchered records shown