Artemisia vulgaris
speciesAt a glance
Occurrence records676 023
Data sources17
Biological traits59
DNA specimens55
eDNA detections45
Sources17 archives
Databases and archives Artemisia vulgaris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility676 023 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI45 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics55 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources59 traits
Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS5 788 compounds
Occurrence & distributionGBIF676 023 records
Environmental DNA2 datasets · 9 countries45 detections
DNA & barcodingBOLD · NCBI55 specimens
Genome at a glanceCCDB · GIFT · GoaT3.4 Gbp
01Narrative
L'Armoise commune ou Armoise citronnelle est une espèce de plantes herbacées vivaces de la famille des Astéracées ou Composées (Asteraceae). Elle est commune dans les régions tempérées, parfois cultivée comme ornementale, appréciée pour son feuillage découpé. Certaines de ses propriétés médicinales sont connues depuis l'Antiquité ; elles ont connu un regain d'intérêt scientifique et de popularité, en raison de nouvelles propriétés découvertes dans les années 1990-2020.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology23
Fruit length max1 mm
Fruit length min0.8 mm
Fruit width max0.3 mm
Fruit width min0.1 mm
Leaf length65 mm
Leaf length max100 mm
Leaf length min25 mm
Leaf mass255 mg
Leaf size2 574 mm²
⚠ sources differ — TRY: 2 574 mm² · LEDA: 5 289 mm² · GIFT: 3 914 mm²
Leaf width37.5 mm
Leaf width max60 mm
Leaf width min15 mm
Plant height1.4 m
⚠ sources differ — GIFT: 1.4 m · LEDA: 1.4 m · TRY: 1.16 m
Plant height generative0.988 m
Plant height max1.6 m
Plant height min0.3 m
Seed length1.34 mm
Seed mass0.155 mg
⚠ sources differ — TRY: 0.155 mg · LEDA: 0.127 mg · GIFT: 0.154 mg
Seed mass max0.206 mg
Seed mass min0.12 mg
Seed volume0.145 mm³
Seed volume max0.15 mm³
Seed volume min0.14 mm³
Life cycle & reproduction14
Deciduousnesssemi-evergreen
⚠ sources differ — TRY: semi-evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endAug
Flowering startAug
Life formperennial
Life spanperennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
⚠ sources differ — LEDA: Chamaephyte · GIFT: hemicryptophyte
Reproduction asexualabsent
Seed number200 000
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 800 m
Elevation min450 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTÁrea Antrópica
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio18.32 g/g
Leaf c463 mg/g
Leaf dry-matter content (LDMC)256 mg/g
Leaf n28.17 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)26.63 mm²/mg
⚠ sources differ — TRY: 26.63 mm²/mg · LEDA: 22.9 mm²/mg · GIFT: 24.12 mm²/mg
Other traits1
Diaspore typegenerative dispersule
03Chemical composition5 788 compounds
Compounds documented for Artemisia vulgaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Aminoacids67
Glycerophospholipids57
Cinnamic acids and derivatives31
Fatty alcohols27
Purine nucleos(t)ides26
Documented compounds5 788 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Inulin | 10,000 mg/100g | FooDB | |
| Potassium | 3,620 mg/100g | FooDB | |
| Calcium | 950 mg/100g | FooDB | |
| Chlorine | 945 mg/100g | FooDB | |
| L-Ascorbic acid | 319.5 mg/100g | FooDB | |
| Sulfur | 255 mg/100g | FooDB | |
| Iron | 255 mg/100g | FooDB |
05DNA & barcoding55 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia vulgaris has left across the world's sequence archives.
At a glance
DNA specimens55
Marker genes9
GenBank sequences10
eDNA detections45
Countries11
The DNA barcodea real sequence read deposited for this species
GCAGAACGACCCGTGAACACGTAAAAACAACTGAGTGTCGGTTGGATCAAGCGCTTGTTTGGTCCTCTCGACGCTTTGTCGACGCGCGTT …
Artemisia vulgaris genomic DNA sequence contains 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2, 28S rRNA gene, specimen voucher BR0000027059425V (F. Lomer 12550, M21-0008)
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT · GoaT
The complete instruction manual Artemisia vulgaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 374 100 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Artemisia vulgaris3.37 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records16–542n range16median16mode145records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1696×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +16
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — MARTINOLI G., OGLIOTTI P. - 1970. Ricerche citotassonomiche in Artemisia vulgaris L. ed Artemisia verlotorum Lamotte.. Giorn. Bot. Ital. , 104(5): 373-387.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · iapt
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — James, C.M. (1988)
CCDB · brit-fl — Valles, J., Siljak-Yakovlev, S. Canad. J. Bot. 75: 595-606 (1997)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4039
CCDB · fl-europaea — Gadella & Kliphuis
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Kaul, M. K. & S. K. Bakshi. 1984. Studies on the genus Artemsia L. in north-west Himalaya with particular reference to Kashmir. Folia Geobot. Phytotax. 19: 299–316.
CCDB · ipcn-api-dl — Noguchi, J., S. Nakayama & S. Kawano. 1983. Karyotype analysis of Artemisia rubripes, an introduced species from the Asiatic continent into Hokkaido, Japan, and a European species, A. vulgaris J. Phytogeogr. Tax. 31: 78–83.
CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.
CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1989. Chromosome numbers in representatives of some families of the flora of the Soviet far east. Bot. Žhurn. (Moscow & Leningrad) 74: 1810–1811.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1990. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 1622–1624.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1991. Chromosome numbers in some species of vascular plants from the Pechoro-Ilychsky Reservation (Komi ASSR). Bot. Žhurn. (Moscow & Leningrad) 76: 473–476.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & L. G. Ulle. 1992. Kariologicheskie osobennosti i rasprostranenie predstavitelej semejstva Asteraceae v Pechoro--Ilychskom Biosfernom Zapovednike. Trudy Komi Nauchnogo Tsentra UrO AN SSSR 126: 52–64.
CCDB · ipcn-api-dl — Bran|9as, M. O. & J. V. Xirau. 1994. Karyological studies in some taxa of the genus Artemisia (Asteraceae). Canad. J. Bot. 72: 1126–1135.
CCDB · ipcn-api-dl — Xirau, J. V. & S. Siljak-yakovlev. 1997. Cytogenetic studies in the genus Artemisia L. (Asteraceae): fluorochrome-banded karyotypes of five taxa, including the Iberian endemic species Artemisia barrelieri Besser. Canad. J. Bot. 75: 595–606.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — James, C. M., B. S. Wurzell & C. A. Stace. 2000. A new hybrid between a European and a Chinese species of Artemisia (Asteraceae). Watsonia 23: 139–147.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.
CCDB · ipcn-api-dl — Malakhova, L. A., O. L. Voronova & A. A. KOZLOVA. 1979. Chromosome numbers of some species of the flora of Sibirian lime-forests. Chernevaja Tajga i Problema Reliktov. Tomsk. 47–51.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1976. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 61(6): 873–880.
CCDB · ipcn-api-dl — Morton, J. K. 1977. A cytological study of the Compositae (excluding Hieracium and Taraxacum) of the British Isles. Watsonia 11: 211–223.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1974. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — KARTASHOVA, N. N., L. A. MALAKHOVA & A. A. KOZLOVA. 1974. Study of the chromosomes of the representatives of the Ob region flora. I. Number of chromosomes of the Tomsk district. Naucn. Dokl. Vyss. Shkoly, Biol. Nauki 4: 114–119.
CCDB · ipcn-api-dl — Hoshi, Y., K. Kondo, A. A. Korobkov, I. V. Tatarenko, P. V. Kulikov, V. P. Verkholat, A. Gontcharov, H. Ogura, T. Finamoto, G. Kokubugata, R. Suzuki & H. Matoba. 2004. Cytological study in the genus Artemisia L. (Asteraceae) from Russia. Chromosome Sci. 7: 83–89.
CCDB · ipcn-api-dl — Krasnikov. 2006. Chromosome numbers of some Artemisia species (Asteraceae) from Siberia. Bot. Žhurn. (Moscow & Leningrad) 91(3): 481–482.
CCDB · ipcn-api-dl — Korobkov. 2003. Karyology of the genus Artemisia L. of Baical Siberia. Pages 303--305 in Botanical Study in Asiatic Russia. Vol. 1. Barnaul.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-indian_vol1 — Tischler, G. 1934; Clausen, J., Keck, D.D. & Hiesey, W.M. 1939 ; Keck, D.D. 1946 ; P61ya, L. 1949 ; Wulff, H.D. 1950 ; Love, A. & Love, D. 1956b; Mulligan, G.A. 1957 ; Urbanska (Skalinska, M. et al. 1959) ; Sorsa. V. 1962 ; Gadella, T.W.J. & Kliphuis, E. 1963 ; Zhukova, P.G. (Fedorov) ; Kawatani, T. & Ohno, T. 1964 ; Marti- noH, G. & Ogliotti, P. 1970; Fernandes, A. & Queiros, M. 1971 ; Laane, M.M. 1971
+52 more references
2n 1817×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-indian_vol1 +3
CCDB · iapt
CCDB · ipcn-api-dl — Magulaev, A. Y. 1992. Chromosome numbers in some species of vascular plants of the northern Caucasus flora. Bot. Žhurn. (Moscow & Leningrad) 77(10): 88–90.
CCDB · book-indian_vol1 — Weinedel-Liebau, F. 1928 ; Mehra, P.N. et al. 1965
CCDB · book-atlas-flowering-plants — Weinedel 1928
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Bakshi, S. K. (1982). Presence of B-chromosomes in Artemisia vulgaris Nucleus 25: 116-118
CCDB · CromoCat 2015 — Clausen, J., Keck, D. D. & Hiesey, W. M. (1938). Experimental taxonomy Carnegie Inst. Wash. Year Book 37: 218-222
CCDB · CromoCat 2015 — Khoshoo, Y. N. & Sobti, S. N. (1958). Cytology of Indian Species of Artemisia [sic]. Nature 181(4612): 853-854.
CCDB · CromoCat 2015 — Koul, M. L. H. (1964a). Cytomorphological survey of Indian Artemisia L. Jour. Sci. Res. Banaras Hindu Univ. 14(2): 103-110
CCDB · CromoCat 2015 — Koul, M. L. H. (1964b). Chromosome numbers in some medicinal composites Proc. Indiana Acad. Sci. 59 (2): 72-77
CCDB · CromoCat 2015 — Magulaev, A. Y. (1992). Chromosome numbers in some species of vascular plants of the northen Caucasus flora Bot. Žurn. 77(10): 88-90
CCDB · CromoCat 2015 — Mehra, P.N. , Gill B.S., Mehta J.K., Sidhu S.S. (1965b). Cytological investigations on the Indian Compositae. I. North-Indian taxa. Caryologia 18(1): 35-68
CCDB · CromoCat 2015 — Weinedel-Liebau F. (1928). Zytologische Untersuchungen an Artemisia-Arten Jahrb. Wiss. Bot. 69: 636-686
CCDB · CromoCat 2015 — Zhukova, P. G. (1967). Kariology of some plants, cultivated in the Arctic-Alpine Botanical Garden.N. A. Avrovin (eds.), Plantarum in Zonam Polarem Transportatio. II. 2: 139-149. Leningrad.
GIFT · GIFT (floras)
2n 3613×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · kew +2
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt
CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1986. Chromosome numbers in some species of Asteraceae from the southern part of the Soviet far east. Bot. Zhurn. 71: 1693.
CCDB · ipcn-api-dl — Hoshi, Y., K. Kondo, A. A. Korobkov, I. V. Tatarenko, P. V. Kulikov, V. P. Verkholat, A. Gontcharov, H. Ogura, T. Finamoto, G. Kokubugata, R. Suzuki & H. Matoba. 2004. Cytological study in the genus Artemisia L. (Asteraceae) from Russia. Chromosome Sci. 7: 83–89.
CCDB · ipcn-api-dl — Probatova. 2005. Chromosome numbers of some dicotyledons of the flora of the Amur Region. Bot. Žhurn. (Moscow & Leningrad) 90(5): 779–792.
CCDB · kew — Garcia S, Sanz M, Garnatje T et al. 2004. Variation of DNA amount in 47 populations of the subtribe Artemisiinae and related taxa (Asteraceae, Anthemideae): karyological, ecological, and systematic implications. Genome 47: 1004-1014.
CCDB · CromoCat 2015 — Clausen, J., Keck, D. D. & Hiesey, W. M. (1938). Experimental taxonomy Carnegie Inst. Wash. Year Book 37: 218-222
CCDB · CromoCat 2015 — Estes, J. (1968). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XV]. Taxon 17(1): 91-104.
CCDB · CromoCat 2015 — Khoshoo, Y. N. & Sobti, S. N. (1958). Cytology of Indian Species of Artemisia [sic]. Nature 181(4612): 853-854.
CCDB · CromoCat 2015 — Koul, M. L. H. (1964a). Cytomorphological survey of Indian Artemisia L. Jour. Sci. Res. Banaras Hindu Univ. 14(2): 103-110
CCDB · CromoCat 2015 — Nirmala, A. & P. N. Rao. (1984). Karyotype studies in Asteraceae Cell Chromosome Res. 7: 26-28
CCDB · iapt — IAPT/IOPB Chromosome Data 23
GIFT · GIFT (floras)
2n 547×CCDB · iapt · CCDB · book-ipcn72 · CCDB · CromoCat 2015 +1
CCDB · iapt
CCDB · book-ipcn72 — KOROBKOV, A.A. 1972. On the cytotaxonomical characteristics of some species of the genus Artemisia L. in the North-East of the U.S.S.R. (in Russian) Bot. Zurn. 57: 1316-1327.
CCDB · CromoCat 2015 — Clausen, J., Keck, D. D. & Hiesey, W. M. (1938). Experimental taxonomy Carnegie Inst. Wash. Year Book 37: 218-222
CCDB · CromoCat 2015 — Khoshoo, Y. N. & Sobti, S. N. (1958). Cytology of Indian Species of Artemisia [sic]. Nature 181(4612): 853-854.
CCDB · CromoCat 2015 — Koul, M. L. H. (1964a). Cytomorphological survey of Indian Artemisia L. Jour. Sci. Res. Banaras Hindu Univ. 14(2): 103-110
CCDB · CromoCat 2015 — Nirmala, A. & P. N. Rao. (1984). Karyotype studies in Asteraceae Cell Chromosome Res. 7: 26-28
GIFT · GIFT (floras)
2n 246×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +2
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · book-ipcn67-71 — SHARMA, A., & A.K. SARKAR (Editors). 1967-68. Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Department of"li"otany, University of Calcutta. The Research Bulletin. 2: 38-Q8.
CCDB · book-indian_vol1 — Sharma, A. & Sarkar, A.K. 1967-1968
CCDB · CromoCat 2015 — Sharma, A. & A.K. Sarkar. (1967). Chromosome number reports of plants in Annual Report, Cytogenetics Laboratory, Departmernt of Botany, University of Calcutta. The research Bulletin 2: 38-48
CCDB · CromoCat 2015 — Sharma, A. K. (1970). Annual report, 1967-1968 Res. Bull. Univ. Calcutta (Cytogenetics Lab.) 2: 1-50
GIFT · GIFT (floras)
2n 343×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · book-ipcn73-74 — MIYAGI, C. 1974. Chromosome numbers in sperrnatophytes from Okinawa Islands (II). Bilo. Mag. Okinawa 10: 17-25.
CCDB · CromoCat 2015 — Torrell, M., N. García-Jacas, A. Susanna & J. Vallés (1999). Phylogeny in Artemisia (Asteraceae, Anthemideae) inferred from nuclear ribosomal DNA (ITS) sequences. Taxon 48(4): 721-736.
2n 403×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1989. Karyotype studies in some Asteraceae. Cell Chromosome Res. 12: 17–18.
CCDB · CromoCat 2015 — Nirmala, A. & P. N. Rao. (1984). Karyotype studies in Asteraceae Cell Chromosome Res. 7: 26-28
CCDB · CromoCat 2015 — Nirmala, A. & P. N. Rao. (1989). Karyotype studies in some Asteraceae. Cell Chromosome Res. 12: 17-18
2n 452×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1974). Cytological investigations on the Indian Compositae. II. Astereae, Heliantheae, Helenieae and Anthemideae. Caryologia 27(3): 255-284.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
n 823×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +3
CCDB · iber-fl — Aportacin al conocimiento citotaxonmico de ocho txones ibricos del gnero Artemisia L. (Asteraceae). Valls Xirau, J.Anales Jard. Bot. Madrid44(1): 79-96(1987).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 422-426. Aparicio, A.Anales Jard. Bot. Madrid43(2): 427-430(1987).
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 446-451. Devesa, J. A. & M. C. Viera.Anales Jard. Bot. Madrid44(2): 509-512(1987).
CCDB · ipcn-api-dl — Vallés Xirau, J. 1987. Aportación al conocimiento citotaxonómico de ocho táxones Ibéricos del género Artemisia L. (Asteraceae, Anthemideae). Anales Jard. Bot. Madrid 44: 79–96.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Devesa, J. A. & M. C. Viera. 1987. Números cromosomáticos de plantas occidentales, 446--451. Anales Jard. Bot. Madrid 44: 509–512.
CCDB · ipcn-api-dl — Aparicio Martínez, A. 1986. Números cromosomáticos de plantas occidentales, 422--426. Anales Jard. Bot. Madrid 43: 427–430.
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Stahevitch, A. E. & W. A. Wojtas. 1988. Chromosome numbers of some North American species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672–676.
CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.
CCDB · Cave1956supp — Keck 1946
CCDB · Cave1963 — Sorsa 1962
CCDB · CromoCat 2015 — Devesa, J. A. & Viera Benítez, M. C. (1987). Números cromosomáticos de plantas occidentales. 446-451. Anales Jard. Bot. Madrid 44(2): 509-512.
CCDB · CromoCat 2015 — Vallés Xirau, J. (1987a). Aportación al conocimiento citotaxonómico de ocho táxones ibéricos del género Artemisia L. (Asteraceae, Anthemideae). Anales Jard. Bot. Madrid 44(1): 79-96.
CCDB · CromoCat 2015 — Aparicio, A. (1986). Números cromosomáticos de plantas occidentales, 422-426 Anales Jard. Bot. Madrid 43: 427-430
CCDB · CromoCat 2015 — Aparicio, A. (1987a). Números cromosomáticos de plantas occidentales, 422-426. Anales Jard. Bot. Madrid 43(2): 427-430.
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Estes, J. (1968). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XV]. Taxon 17(1): 91-104.
CCDB · CromoCat 2015 — Laane, M. M. (1971). Chromosome numbers in Norwegian vascular plant species 6. Blyttia 29: 229-234.
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
CCDB · CromoCat 2015 — Stahevitch, A. E. & W. A. Wotjas. (1988). Chromosome numbers of some North american species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672-676.
n 99×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +1
CCDB · book-ipcn65 — Mehra et al. 1965
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1988. SOCGI plant chromosome number reports -- VI. J. Cytol. Genet. 23: 38–52.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Gupta, R. C., B. S. Gill & R. K. Garg. 1989. Chromosomal conspectus of western Himalayan Compositae. Aspects Pl. Sci. 11: 427–437.
CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1988). SOCGI plant chromosome number reports-VI J. Cytol. Genet. 23: 38-52
CCDB · CromoCat 2015 — Gupta, R. C. & Gill, B. S. (1989). Cytopalynology of north and central Indian Compositae J. Cytol. Genet. 24: 96-105.
CCDB · CromoCat 2015 — Gupta, R. C., Gill, B. S. & Garg, R. K. (1989). Chromosomal conspectus of western Himalayan Compositae. Aspects Pl. Sci. 11: 427-437
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1974). Cytological investigations on the Indian Compositae. II. Astereae, Heliantheae, Helenieae and Anthemideae. Caryologia 27(3): 255-284.
n 05×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Korobkov (2003). Karyology of the genus Artemisia L. of Baical Siberia.In Botanical Study in Asiatic Russia. Vol. 1. Barnaul. 303–305
CCDB · CromoCat 2015 — Korobkov, A. A., Kotseruba, V. V., Probatova, N. S. & Gnutikov, A. A.
Nina S. Probatova2* & Aleksandr A. Gnutikov1 (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:895-897
CCDB · CromoCat 2015 — Krasnikov (2006). Chromosome numbers of some Artemisia species (Asteraceae) from Siberia. Bot. Žhurn. 91(3): 481–482.
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
n 274×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Gill, B. S., S. S. Bir & G. Singh. 1982. In: IOPB chromosome number reports LXXVII. Taxon 31: 775–776.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · CromoCat 2015 — Gill, B. S., Bir, S. S. & Singh, G. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(4): 775.
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
n 182×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Gupta, R. C. & R. K. Garg. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 162–163.
CCDB · CromoCat 2015 — Gupta, R. C. & Garg, R. K. (1987). SOCGI plant chromosome number reports-IV (i.e., V) J. Cytol. Genet. 22: 162-163
n 451×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type676 023 records
Wild obs. + sensor655 667
Museum / vouchered18 612
Cultivated / captive81
Fossil1
Other1 662
Origin
Native2 806
Introduced8 372
Range
Area of Occupancy AOO672 064 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy47% within 1 km
≤100 m 159 499≤1 km 101 041≤10 km 291 423>10 km 5 763
557 726 georeferenced · 97 941 without coordinates
Open the mapobservation + sensor655 667
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy36% within 1 km
≤100 m 802≤1 km 4 090≤10 km 8 168>10 km 486
13 546 georeferenced · 5 066 without coordinates
Open the institutions mapphysical evidence18 612
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy9% within 1 km
≤100 m 2≤1 km 1≤10 km 13>10 km 16
32 georeferenced · 49 without coordinates
Open the mapnot free-living81
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions191 of 373 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 9 766 |
| BFLlocation not on record | 605 |
| BIO-UNIPIlocation not on record | 422 |
| Moscow State Universitylocation not on record | 405 |
| LDlocation not on record | 307 |
| Görlitz, DE | 249 |
| Uniwersytet Warszawskilocation not on record | 221 |
| Kuopio, FI | 216 |
| BRNUlocation not on record | 215 |
| Olocation not on record | 177 |
| Salzburg, AT | 166 |
| MeiseBGlocation not on record | 143 |
| Berlin, DE | 134 |
| Québec, CA | 127 |
| Mlocation not on record | 114 |
| Bergen, NO | 112 |
| TROMlocation not on record | 105 |
| Philadelphia, US | 103 |
| Trondheim, NO | 99 |
| Chongqing Museumlocation not on record | 98 |
| Oskarshamn, SE | 95 |
| Oulu, FI | 91 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 86 |
| Montréal, CA | 83 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 77 |
| Karlsruhe, DE | 77 |
| Turku, FI | 72 |
| KMNlocation not on record | 70 |
| Jyväskylä, FI | 66 |
| South Kensington, GB | 64 |
| Barcelona, ES | 63 |
| Tartu, EE | 57 |
| Allentown, US | 57 |
| BDBClocation not on record | 56 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 54 |
| Université Lavallocation not on record | 54 |
| Adam Mickiewicz University in Poznańlocation not on record | 53 |
| Bronx, US | 51 |
| SLU Artdatabankenlocation not on record | 45 |
| Provincia di Livornolocation not on record | 43 |
| Saint John, CA | 38 |
| Chapel Hill, US | 34 |
| Tallinn, EE | 34 |
| Beijing, CN | 33 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 33 |
| Uppsala, SE | 33 |
| Bern, CH | 32 |
| UGentlocation not on record | 32 |
| Zürich, CH | 28 |
| IFR-DNFlocation not on record | 28 |
| University of New Hampshirelocation not on record | 27 |
| BClocation not on record | 27 |
| Philadelphia, US | 27 |
| Entomological Society of Latvialocation not on record | 26 |
| Zürich, CH | 25 |
| New Haven, US | 25 |
| Ann Arbor, US | 25 |
| Acadia Universitylocation not on record | 24 |
| Madison, US | 23 |
| Guangzhou, CN | 23 |
| Williamsburg, US | 22 |
| Yangling, CN | 21 |
| Pullman, US | 21 |
| University of Stellenboschlocation not on record | 20 |
| GJOlocation not on record | 20 |
| Natural History Museum Rotterdamlocation not on record | 19 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 19 |
| Frankfurt am Main | 18 |
| Tula State Universitylocation not on record | 17 |
| WTUlocation not on record | 17 |
| Palacký University in Olomouclocation not on record | 17 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 16 |
| Vitoria, ES | 16 |
| College Park, US | 16 |
| Bloomington, US | 16 |
| WNNUlocation not on record | 15 |
| Saint Louis, US | 15 |
| Wuzhou, CN | 14 |
| Wlocation not on record | 14 |
| Urumqi, CN | 12 |
| Nanjing, CN | 12 |
| MAlocation not on record | 12 |
| PrivatHerblocation not on record | 12 |
| CICYTEXlocation not on record | 12 |
| Servico de Microbiologia e Imunologialocation not on record | 12 |
| Uniwersytet Opolskilocation not on record | 12 |
| New Brunswick, US | 11 |
| Logan, US | 11 |
| TUR-Alocation not on record | 11 |
| Vancouver, CA | 11 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Helsinki, FI | 11 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 10 |
| DBF-NHMDlocation not on record | 10 |
| Porvoo, FI | 10 |
| Corvallis, US | 10 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 10 |
| Universidad del Quindío (UniQuindío)location not on record | 9 |
| SWlocation not on record | 9 |
| Nanjing, CN | 9 |
| Paris, FR | 9 |
| Staten Island, US | 9 |
| Dekalb, US | 9 |
| BISHlocation not on record | 9 |
| Toronto, CA | 8 |
| Honolulu, US | 8 |
| SZUlocation not on record | 8 |
| GMBAlocation not on record | 8 |
| Garðabær, IS | 8 |
| Xining, CN | 8 |
| Clemson, US | 8 |
| St. Paul, US | 8 |
| Porrentruy, CH | 7 |
| Ilhéus, BR | 7 |
| GZUlocation not on record | 7 |
| València, ES | 7 |
| Frauenfeld, CH | 7 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 7 |
| Millersville, US | 7 |
| Chaguaramas, TT | 7 |
| Wuhan, CN | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Pamplona, ES | 7 |
| Salamanca, ES | 6 |
| IDElocation not on record | 6 |
| Hudson, US | 6 |
| Durango, MX | 6 |
| Nagasaki University - Fisherieslocation not on record | 6 |
| NMBU:MINAlocation not on record | 6 |
| Taipei, TW | 6 |
| Mérida, MX | 6 |
| Bangkok, TH | 6 |
| Denver, US | 6 |
| Whitehorse, CA | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| FJIDClocation not on record | 5 |
| Burlington, US | 5 |
| Hangzhou, CN | 5 |
| Pretoria, ZA | 5 |
| Cenargenlocation not on record | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 5 |
| Knoxville, US | 5 |
| Forssa, FI | 5 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 5 |
| Tianjin Natural History Museumlocation not on record | 5 |
| CJBGlocation not on record | 5 |
| San Sebastián, ES | 5 |
| Brasília, BR | 5 |
| Christchurch, NZ | 5 |
| UnBlocation not on record | 5 |
| Departamento de Sistematica e Ecologialocation not on record | 4 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 4 |
| Provo, US | 4 |
| ISAlocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| UNIVASFlocation not on record | 4 |
| 4 | |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Universidade Federal do Vale do São Franciscolocation not on record | 4 |
| EL PASO, US | 4 |
| Columbia, US | 4 |
| Bourges, FR | 4 |
| Western Carolina Universitylocation not on record | 4 |
| H-Schuhwlocation not on record | 4 |
| Rovaniemi, FI | 4 |
| University of Alberta Museumslocation not on record | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Dresden, DE | 4 |
| Badajoz, ES | 4 |
| León, NI | 4 |
| Seoul, KR | 4 |
| FJFClocation not on record | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Madrid, ES | 3 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| Norfolk, US | 3 |
| Xiamen, CN | 3 |
| Universidade Federal do Maranhãolocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Philadelphia, US | 3 |
| Stockholm, SE | 3 |
| CEPLAClocation not on record | 3 |
| Masindi, UG | 3 |
| Bando, JP | 3 |
| Riverside, US | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Missoula, US | 3 |
| Université de Bordeauxlocation not on record | 3 |
| Tilburg, NL | 3 |
| McWane Science Centerlocation not on record | 3 |
| Santa Barbara, US | 3 |
| Claremont, US | 3 |
| UFRPElocation not on record | 3 |
| Fairfax, US | 3 |
| Green Bay, US | 3 |
| Jena Microbial Resource Collectionlocation not on record | 3 |
| Boise, US | 3 |
| Tacoma, US | 3 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 3 |
| Guilin, CN | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Shanxi Universitylocation not on record | 3 |
| Sant Julià de Lòria, AD | 3 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 3 |
| Victoria, CA | 3 |
| Keene State Universitylocation not on record | 3 |
| National Biodiversity Institute, Costa Ricalocation not on record | 3 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 3 |
| Dover, US | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| Pocatello, US | 2 |
| Miami, US | 2 |
| Flagstaff, US | 2 |
| JBSlocation not on record | 2 |
| UTFPR-CPlocation not on record | 2 |
| Alicante, ES | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Blumenau, BR | 2 |
| Wuhan, CN | 2 |
| Dehra Dun, IN | 2 |
| Harrisonburg, US | 2 |
| Canberra, AU | 2 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Kunming, CN | 2 |
| Oswego, US | 2 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 2 |
| Minia, EG | 2 |
| IWEP FEB RASlocation not on record | 2 |
| UFBAlocation not on record | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Glarus, CH | 2 |
| Tampa, US | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Kandalaksha State Nature Reservelocation not on record | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Capital Normal Universitylocation not on record | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Jackson, US | 2 |
| Chicago, US | 2 |
| INMAlocation not on record | 2 |
| UNESClocation not on record | 2 |
| GAlocation not on record | 2 |
| Kew, GB | 2 |
| UFRRJlocation not on record | 2 |
| München, DE | 2 |
| UEPAlocation not on record | 2 |
| Campo Mourão, BR | 2 |
| Hazara Universitylocation not on record | 2 |
| Bozeman, US | 2 |
| Auckland, NZ | 2 |
| Porto Alegre, BR | 2 |
| CASlocation not on record | 2 |
| Universidade Federal de Sergipe (UFS)location not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Uberlândia, BR | 2 |
| DASSHlocation not on record | 2 |
| Little Rock, US | 2 |
| Lanzhou, CN | 2 |
| Portland, US | 2 |
| ASUlocation not on record | 2 |
| Criciúma, BR | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Emporia, US | 2 |
| Göteborg, SE | 2 |
| Appalachian State Universitylocation not on record | 2 |
| Guangzhou, CN | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| CPATSAlocation not on record | 1 |
| Toyama, JP | 1 |
| Irvine, US | 1 |
| Ivano-Frankove, UA | 1 |
| Salvador, BR | 1 |
| Davis, US | 1 |
| Durham, US | 1 |
| Long Beach, US | 1 |
| Bothell, US | 1 |
| Moscow, US | 1 |
| LfUlocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Wellington, NZ | 1 |
| Whitewater, US | 1 |
| PRClocation not on record | 1 |
| Chicago, US | 1 |
| San Luis Obispo, US | 1 |
| Xian, CN | 1 |
| Ashland, US | 1 |
| Asheville, US | 1 |
| BioFokuslocation not on record | 1 |
| HACAMlocation not on record | 1 |
| Washington, US | 1 |
| SCAUlocation not on record | 1 |
| Sevilla, ES | 1 |
| Awka, NG | 1 |
| Ivano-Frankivsk, UA | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| UNESP-IBILCElocation not on record | 1 |
| UIBlocation not on record | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| Kingston, US | 1 |
| Tapachula, MX | 1 |
| Turlock, US | 1 |
| San Francisco de Campeche, MX | 1 |
| TADlocation not on record | 1 |
| FLASlocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Mississippi State, US | 1 |
| CBDClocation not on record | 1 |
| State University of New York, College at Oneontalocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| INBIOlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Namur, BE | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| Yunnan Universitylocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Shanghai, CN | 1 |
| Granada, ES | 1 |
| San José, CR | 1 |
| Universidad de la Amazonia (UniAmazonia)location not on record | 1 |
| Vietnam Academy of Science and Technology (VAST)location not on record | 1 |
| GB | 1 |
| WINlocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Kensington, AU | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Hobart, AU | 1 |
| Parkville, AU | 1 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 1 |
| Tuscaloosa, US | 1 |
| UChlocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| BSBIlocation not on record | 1 |
| NMWlocation not on record | 1 |
| Pamplona, ES | 1 |
| nbflocation not on record | 1 |
| Fort Worth, US | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Gijón, ES | 1 |
| Sion, CH | 1 |
| Hamilton, US | 1 |
| Montréal, CA | 1 |
| H-Adlerlocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| UFMGlocation not on record | 1 |
| Podgorica, ME | 1 |
| Fulda, DE | 1 |
| Davenport, US | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Palmerston, AU | 1 |
| Maringá, BR | 1 |
| IPE-CSIClocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| UFSClocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Bogotá, D.C., CO | 1 |
| Peking Universitylocation not on record | 1 |
373 institutions · 17 004 of 18 612 vouchered records shown · 1 131 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA45 detections
Where the DNA of Artemisia vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found45
Studies independent surveys2
Countries9
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 45 detections have coordinates
Open the map9 countries0
meadow
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.7 °C 8.40–16.3
Seasonal swing summer↔winter15.5 °C
Max temp (day)15.2 °C 10.4–20.8
Min temp (night)11.1 °C 4.70–12.9
Precipitation72.2 mm/mo 58.2–95.1
Air humidity63.1 % 60.2–63.7
Moisture balance4.50 mm/mo
Vapour deficit575 Pa 424–704
Wind speed4.20 m/s
Cloud cover48.9 % 42.9–61.7
CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.