Artemisia verlotiorum
Lamotte · speciesAt a glance
Occurrence records32 092
Data sources14
Biological traits46
DNA specimens11
eDNA detections6
Sources14 archives
Databases and archives Artemisia verlotiorum's data was compiled from.
WikipediaWikimedia Foundation7 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility32 092 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics11 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources46 traits
Chemical compositionLOTUS · NPASS20 compounds
Occurrence & distributionGBIF32 092 records
Environmental DNA1 datasets · 2 countries6 detections
DNA & barcodingBOLD · NCBI11 specimens
Genome at a glanceCCDB · GoaT6.1 Gbp
01Narrative
Artemisia verlotiorum, the Chinese mugwort, is a species of plant in the sunflower family, widespread across much of Eurasia.Flora of China, 南艾蒿 nan ai hao Artemisia verlotorum Lamotte, Mém. Assoc. Franç. Congr. Clermont Ferrand. 1876: 511. 1876.Altervista Flora Italiana, Assenzio dei fratelli Verlot, Artemisia verlotiorum Lamotte
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology12
Fruit length1 mm
Leaf length75 mm
Leaf length max180 mm
Leaf length min50 mm
Leaf width30 mm
⚠ sources differ — AusTraits: 30 mm · GIFT: 118 mm
Leaf width max80 mm
Leaf width min30 mm
Plant height1.8 m
⚠ sources differ — GIFT: 1.8 m · AusTraits: 2 m · LEDA: 1.6 m · TRY: 1.61 m
Plant height generative2 m
Plant height max3 m
Plant height min0.5 m
Seed length1.35 mm
Life cycle & reproduction15
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: unspecialized
Flowering endNov
Flowering startOct
Flowering timeyyyyynnnnnny
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Self fertilizationpresent
Sex typemonoecious
Diet & foraging1
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf shapelinear orbicular ovate
Woodinesswoody
⚠ sources differ — TRY: woody · AusTraits: herbaceous · GIFT: non-woody
Physiology & chemistry5
Leaf c480 mg/g
Leaf dry-matter content (LDMC)327 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Other traits1
Diaspore typefruit
03Chemical composition20 compounds
Compounds documented for Artemisia verlotiorum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Germacrane sesquiterpenoids8
Eudesmane sesquiterpenoids2
Flavones2
Aromadendrane sesquiterpenoids2
Arteminisin1
Documented compounds20 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-Caryophyllene | present | LOTUS | |
| (1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol | present | LOTUS | |
| (1R,5S)-4,6,6-trimethylbicyclo[3.1.1]hept-3-en-2-one | present | LOTUS | |
| (3aS,10E,11aS)-10-methyl-3,6-dimethylidene-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2,7-dione | present | LOTUS | |
| (3aS,6E,11aR)-6,10-dimethyl-3-methylidene-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one | present | LOTUS | |
| (3aS,7R,10E,11aS)-7-hydroxy-10-methyl-3,6-dimethylidene-4,5,7,8,9,11a-hexahydro-3aH-cyclodeca[b]furan-2-one | present | LOTUS | |
| (3aS,7R,8S,10E,11aR)-7,8-dihydroxy-10-methyl-3,6-dimethylidene-4,5,7,8,9,11a-hexahydro-3aH-cyclodeca[b]furan-2-one | present | LOTUS | |
| (3S,3aS,5aR,9R,9aS,9bS)-3a,5,5a,9,9a,9b-Hexahydro-9-hydroxy-3,5a,9-trimethylnaphtho(1,2-b)furan-2,6(3H,4H)-dione | present | LOTUS | |
| 6-Hydroxyluteolin 6,7,3',4'-tetramethyl ether | present | LOTUS | |
| Anethole | present | NPASS |
05DNA & barcoding11 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia verlotiorum has left across the world's sequence archives.
At a glance
DNA specimens11
Marker genes3
GenBank sequences10
eDNA detections6
Countries3
The DNA barcodea real sequence read deposited for this species
TCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTAAAAACAACCGAGCGTCGGTTGGACCAAGCGCTTGTTTGGTCCTCTCGACGCTT …
Artemisia verlotiorum voucher Denters M2231 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★ITS9
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Artemisia verlotiorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size6 132 060 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Artemisia verlotiorum6.13 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidypolyploid inferred
Chromosome records16–542n range48median48mode27records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 489×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · ipcn-api-dl +2
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — MARTINOLI G., OGLIOTTI P. - 1970. Ricerche citotassonomiche in Artemisia vulgaris L. ed Artemisia verlotorum Lamotte.. Giorn. Bot. Ital. , 104(5): 373-387.
CCDB · ipcn-api-dl — Vallés Xirau, J. 1987. Aportación al conocimiento citotaxonómico de ocho táxones Ibéricos del género Artemisia L. (Asteraceae, Anthemideae). Anales Jard. Bot. Madrid 44: 79–96.
CCDB · ipcn-api-dl — Xu, B. s., R. f. Weng & M. z. Zhang. 1992. Chromosome numbers of Shanghai plants I. Invest. Stud. Nat. 12: 48–65.
CCDB · ipcn-api-dl — Gabrielian, E. & J. V. Xirau. 1996. New data about the genus Artemisia L. (Asteraceae) in Armenia. Willdenowia 26: 245–250.
CCDB · kew — Garcia S, Hidalgo O, Jakovljević I, Siljak-Yakovlev S, Vigo J, Garnatje T, Vallès J. 2013. New data on genome size in 128 Asteraceae species and subspecies, with first assessments for 40 genera, 3 tribes and 2 subfamilies. Plant Biosystems 147: 1219-1227.
CCDB · CromoCat 2015 — Gabrielian, E. & Xirau, J. V. (1996). New data about the genus Artemisia L. (Asteraceae) in Armenia. Willdenowia 26: 245–250.
CCDB · CromoCat 2015 — Vallés Xirau, J. (1987a). Aportación al conocimiento citotaxonómico de ocho táxones ibéricos del género Artemisia L. (Asteraceae, Anthemideae). Anales Jard. Bot. Madrid 44(1): 79-96.
CCDB · CromoCat 2015 — Xu, B.-S., R.-F. Weng & M.-Z. Zhang. (1992). Chromosome numbers of Shangai plants I. Invest. Stud. Nat. (Shangai) 12: 48-65.
2n 549×CCDB · ita-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +2
CCDB · ita-fl — VIGNOLI L. - 1945. Sterilit e moltiplicazione vegetativa in "Jaborosa", "Artemisia", "Hemerocallis".. N. Giorn. Bot. Ital., n.s. , 52: 1/10/2000.
CCDB · fl-europaea — Vignoli, 1945
CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1988. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 1]. Ber. Bayer. Bot. Ges. 59: 13–22.
CCDB · ipcn-api-dl — Rotreklova. 2004. Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
CCDB · book-atlas-flowering-plants — Vignoli 1945a
CCDB · CromoCat 2015 — Rotreklova. (2004). Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
CCDB · CromoCat 2015 — Lippert, W. & Heubl, G.R. (1988). Chromosomenzahlen von Pflanzen aus Bayern und angrenzeden Gebieten (Teil 1) Ber. Bayer. Bot. Ges. 59: 13-22.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. (1960). Geograficheskoye rasprostraneny poliploidnich vidov rasteny (issledovanie flory o. Sakhalina). Vestn. Leningr. Univ. Ser. Biol. 21: 42-58.
CCDB · CromoCat 2015 — Vignoli, L. (1945). Sterilità e moltiplicazione vegetativa in Jaborosa, Artemesia, Hemerocallis Nuovo Giorn. Bot. Ital. 52(1): 1-10
2n 163×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Oliva Brañas, M. & J. V. Xirau. 1991. Contribution to the cytotaxonomical knowledge of the genus Artemisia L.: Giemsa C-banded karyotypes of some taxa. Bot. Chron. (Patras) 10: 737–740.
CCDB · CromoCat 2015 — Kawatani, T. & Ohno, T. (1964). Chromosome numbers in Artemisia. Bull. Nat. Inst. Hyg. Sci. 82: 183-193.
CCDB · CromoCat 2015 — Oliva Brañas, M. & J. Vallès Xirau (1991). Contribution to the cytotaxonomical knownedge of the genus Artemisia L.: Giemsa C-banded karyotypes of some taxa. Bot. Chron. 10: 737-740
2n 502×CCDB · brit-fl · CCDB · CromoCat 2015
CCDB · brit-fl — James, C.M. (1988)
CCDB · CromoCat 2015 — James, C. M., Wurzell, B. S. & Stace, C. A. (2000). A new hybrid between a European and a Chinese species of Artemisia (Asteraceae). Watsonia 23: 139–147.
2n 522×CCDB · brit-fl · CCDB · CromoCat 2015
CCDB · brit-fl — James, C.M. (1988)
CCDB · CromoCat 2015 — James, C. M., Wurzell, B. S. & Stace, C. A. (2000). A new hybrid between a European and a Chinese species of Artemisia (Asteraceae). Watsonia 23: 139–147.
2n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kawatani, T. & Ohno, T. (1964). Chromosome numbers in Artemisia. Bull. Nat. Inst. Hyg. Sci. 82: 183-193.
2n 361×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — LEE, Y.N. 1972. Chromosome number of flowering plants in Korea (4). J. Korean Res. Inst. Better Living 8: 41-51.
n 04×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Gabrielian, E. & Xirau, J. V. (1996). New data about the genus Artemisia L. (Asteraceae) in Armenia. Willdenowia 26: 245–250.
CCDB · CromoCat 2015 — James, C. M., Wurzell, B. S. & Stace, C. A. (2000). A new hybrid between a European and a Chinese species of Artemisia (Asteraceae). Watsonia 23: 139–147.
CCDB · CromoCat 2015 — Rotreklova. (2004). Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type32 092 records
Wild obs. + sensor30 045
Museum / vouchered1 394
Other653
Origin
Native105
Introduced540
Range
Area of Occupancy AOO45 320 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy48% within 1 km
≤100 m 9 972≤1 km 1 988≤10 km 12 753>10 km 153
24 866 georeferenced · 5 179 without coordinates
Open the mapobservation + sensor30 045
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy59% within 1 km
≤100 m 111≤1 km 210≤10 km 219>10 km 4
544 georeferenced · 850 without coordinates
Open the institutions mapphysical evidence1 394
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions55 of 104 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 341 |
| MeiseBGlocation not on record | 74 |
| BDBClocation not on record | 73 |
| Barcelona, ES | 58 |
| Provincia di Livornolocation not on record | 58 |
| Salzburg, AT | 49 |
| BFLlocation not on record | 48 |
| Mount Annan, AU | 35 |
| South Kensington, GB | 32 |
| Auckland, NZ | 31 |
| València, ES | 30 |
| Vitoria, ES | 29 |
| Museo Entomologico de Leonlocation not on record | 23 |
| Mlocation not on record | 22 |
| Natural History Museum Rotterdamlocation not on record | 22 |
| Wlocation not on record | 17 |
| Christchurch, NZ | 17 |
| Porto Alegre, BR | 17 |
| Canberra, AU | 16 |
| BClocation not on record | 15 |
| MAlocation not on record | 15 |
| Córdoba, AR | 13 |
| Brisbane, AU | 13 |
| Entomological Society of Latvialocation not on record | 11 |
| BRNUlocation not on record | 11 |
| San Sebastián, ES | 11 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| Alicante, ES | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 8 |
| GJOlocation not on record | 8 |
| Moscow State Universitylocation not on record | 8 |
| Wellington, NZ | 8 |
| Armidale, AU | 7 |
| Edinburgh, GB | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| Salamanca, ES | 6 |
| LDlocation not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| SZUlocation not on record | 6 |
| Rotorua, NZ | 6 |
| CICYTEXlocation not on record | 5 |
| Görlitz, DE | 5 |
| CJBGlocation not on record | 5 |
| LfUlocation not on record | 5 |
| Frauenfeld, CH | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| ISAlocation not on record | 5 |
| GZUlocation not on record | 4 |
| Brussel, BE | 4 |
| Smithfield, AU | 4 |
| Berlin, DE | 4 |
| Granada, ES | 4 |
| San Isidro, AR | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Kew, GB | 3 |
| JBRJlocation not on record | 3 |
| Laboratory of Palaeontologylocation not on record | 3 |
| Badajoz, ES | 3 |
| Museo Achille Folettolocation not on record | 3 |
| FUVATESlocation not on record | 3 |
| Corrientes, AR | 3 |
| Parkville, AU | 2 |
| UFMSlocation not on record | 2 |
| PRClocation not on record | 2 |
| Jaén, ES | 2 |
| WTUlocation not on record | 2 |
| H-Schuhwlocation not on record | 2 |
| Pamplona, ES | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Blumenau, BR | 2 |
| H-Adlerlocation not on record | 2 |
| Vancouver, CA | 2 |
| Banyoles, ES | 2 |
| Bern, CH | 2 |
| Campo Grande, BR | 2 |
| Madrid, ES | 2 |
| CJBNlocation not on record | 2 |
| Elocation not on record | 1 |
| Wuzhou, CN | 1 |
| Minia, EG | 1 |
| Arequipa, PE | 1 |
| Alcaldía Municipal de Garzón en Huilalocation not on record | 1 |
| Lausanne, CH | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Tilburg, NL | 1 |
| Sion, CH | 1 |
| University of Genevalocation not on record | 1 |
| Adelaide, AU | 1 |
| München, DE | 1 |
| Oskarshamn, SE | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| NMWlocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| EEZA-CSIClocation not on record | 1 |
| Bourges, FR | 1 |
| DBF-NHMDlocation not on record | 1 |
| UIBlocation not on record | 1 |
| Zürich, CH | 1 |
| PrivatHerblocation not on record | 1 |
| Ilhéus, BR | 1 |
| Ivano-Frankivsk, UA | 1 |
| Stockholm, SE | 1 |
| Palmerston, AU | 1 |
| Pelotas, BR | 1 |
104 institutions · 1 324 of 1 394 vouchered records shown · 70 without an institution code
09Environmental DNA6 detections
Where the DNA of Artemisia verlotiorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found6
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 6 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.2 °C 15.2–18.1
Seasonal swing summer↔winter14.7 °C
Max temp (day)19.9 °C 18.8–21.9
Min temp (night)14.0 °C 11.4–14.3
Precipitation84.1 mm/mo 82.1–98.1
Air humidity61.6 % 60.9–62.8
Moisture balance-38.1 mm/mo -45.8–17.3
Vapour deficit735 Pa 651–814
Wind speed4.00 m/s 2.50–4.10
Cloud cover38.8 % 38.3–42.4
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.