Artemisia stechmanniana

Besser · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records233

Data sources5

Biological traits18

DNA specimens0

eDNA detections1

Sources5 archives

Databases and archives Artemisia stechmanniana's data was compiled from.

GBIFGlobal Biodiversity Information Facility233 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources18 traits

Chemical compositionLOTUS52 compounds

Occurrence & distributionGBIF233 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max0.8 m

Plant height min0.12 m

Life cycle & reproduction5

Dispersal typewind

Flowering endAug

Flowering startAug

Life formsubshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max4 100 m

Elevation min2 000 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTmountains, stony places

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition52 compounds

Compounds documented for Artemisia stechmanniana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Eudesmane sesquiterpenoids8

Simple coumarins5

Guaiane sesquiterpenoids4

Bisabolane sesquiterpenoids4

Germacrane sesquiterpenoids4

Documented compounds52 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Borneol acetate	present	LOTUS
(-)-3-Isothujone	present	LOTUS
(-)-alpha-Bisabolol	present	LOTUS
(-)-alpha-Curcumene	present	LOTUS
(-)-Zingiberene	present	LOTUS
(1R,4R,5R)-4-methyl-1-[(2R)-1-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxypropan-2-yl]bicyclo[3.1.0]hexan-3-one	present	LOTUS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[[(1S,3R,4R,5R)-4-methyl-1-propan-2-yl-3-bicyclo[3.1.0]hexanyl]oxy]oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5R,6S)-2-(Hydroxymethyl)-6-(2-Methylbut-3-En-2-Yloxy)Oxane-3,4,5-Triol	present	LOTUS
(3aS,5aR,9bS)-5a,9-dimethyl-3a,4,5,7,8,9b-hexahydro-3H-benzo[g][1]benzofuran-2,6-dione	present	LOTUS
(3R,3aS,5aR,9bS)-3,5a,9-trimethyl-3a,4,5,7,8,9b-hexahydro-3H-benzo[g][1]benzofuran-2,6-dione	present	LOTUS

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia stechmanniana has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ860696.1 ↗217 bpChina · 2024

ACGT

CGCATCGCGTCGAATTCTCTGTAAAGGGAACTCGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAAATAGG …

Artemisia stechmanniana voucher YZ-10 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS6

plant barcodefungal barcode

08Occurrence & distribution

Record type233 records

Wild obs. + sensor98

Museum / vouchered135

Range

Area of Occupancy AOO800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 19≤1 km 16≤10 km 13>10 km 4

52 georeferenced · 46 without coordinates

Open the mapobservation + sensor98

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤1 km 6≤10 km 22>10 km 13

41 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	128
Irkutsk State Universitylocation not on record	3
Kochi, JP	2
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1

4 institutions · 134 of 135 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Artemisia stechmanniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)