Artemisia spiciformis

Osterh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records286

Data sources9

Biological traits4

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Artemisia spiciformis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility286 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF286 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT4.4 Gbp

01Narrative

Artemisia spiciformis is a North American species in the sunflower family, with the common name snowfield sagebrush. It grows at high elevations in the mountains, frequently in the vicinity of late-season snow.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction1

Life spanperennial

Habitat & environment3

Climberself-supporting

Growth formTree, Shrub

Woodinesswoody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia spiciformis has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU111667.1 ↗217 bp

ACGT

TCGCGTCGCCCCCCACAACTCTCCGTAAAGGGAGCTTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAAA …

Artemisia spiciformis internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Artemisia spiciformis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 401 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Artemisia spiciformis4.4 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — McArthur, E. D. & S. C. Sanderson. 1999. Cytogeography and chromosome evolution of subgenus Tridentatae of Artemisia (Asteraceae). Amer. J. Bot. 86(12): 1754–1775.

CCDB · kew — Torrell M, Valles J. 2001. Genome size in 21 Artemisia L. species (Asteraceae, Anthemideae): Systematic, evolutionary, and ecological implications. Genome 44: 231-238.

CCDB · kew — Garcia S, Canela MA, Garnatje T, McArthur ED, Pellicer J, Sanderson SC, Valles J. 2008. Evolutionary and ecological implications of genome size in the North American endemic sagebrushes and allies (Artemisia, Asteraceae). Biological Journal of the Linnea

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — McArthur, E. D. & S. C. Sanderson. 1999. Cytogeography and chromosome evolution of subgenus Tridentatae of Artemisia (Asteraceae). Amer. J. Bot. 86(12): 1754–1775.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type286 records

Wild obs. + sensor10

Museum / vouchered276

Range

Area of Occupancy AOO716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 4≤1 km 2≤10 km 2

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy66% within 1 km

≤100 m 6≤1 km 32≤10 km 17>10 km 3

58 georeferenced · 218 without coordinates

Open the institutions mapphysical evidence276

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Logan, US	131
Bronx, US	43
Provo, US	13
Claremont, US	9
Riverside, US	8
Caldwell, US	6
Boise, US	6
CASlocation not on record	4
Davis, US	3
Pullman, US	3
Musee des Dinosaures d'Esperaza (Aude)location not on record	3
US	3
WTUlocation not on record	2
Weber State Universitylocation not on record	2
Los Angeles, US	2
Moscow, US	2
Canadian Department of Agriculturelocation not on record	2
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	2
Orem, US	2
San Luis Obispo, US	2
DOI/NPS, Colonial National Historical Parklocation not on record	1
INFlocation not on record	1
Corvallis, US	1
Pocatello, US	1

24 institutions · 252 of 276 vouchered records shown · 24 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)