Artemisia sieversiana
Ehrh. ex Willd. · speciesAt a glance
Occurrence records4 436
Data sources11
Biological traits41
DNA specimens15
eDNA detections11
Sources11 archives
Databases and archives Artemisia sieversiana's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 436 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS · NPASS75 compounds
Occurrence & distributionGBIF4 436 records
Environmental DNA1 datasets · 4 countries11 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB2n = 18
01Narrative
Полынь Сиверса — вид однолетних и двулетних растений рода Полынь семейства Астровые, или Сложноцветные (Asteraceae). Вид назван в честь Иоганна Сиверса, ботаника, исследовавшего природу Сибири, член-корреспондента Императорской Санкт-Петербургской Академии Наук.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology12
Leaf length60 mm
Leaf length max80 mm
Leaf length min40 mm
Leaf size269 mm²
Leaf width45 mm
Leaf width max60 mm
Leaf width min30 mm
Plant height0.825 m
⚠ sources differ — GIFT: 0.825 m · LEDA: 0.825 m · TRY: 0.049 m
Plant height generative0.9 m
Plant height max1 m
Plant height min0.3 m
Seed mass7.9 mg
Life cycle & reproduction8
DeciduousnessN
Dispersal typewind
Flowering endAug
Flowering startAug
Life formannual or biennial
Life spanperennial
⚠ sources differ — TRY: perennial · GIFT: annual
Lifespan years1.5 years
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 400 m
Elevation min2 600 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTopen roadsides managed
Leaf formlanceolate
Woodinessnon-woody
Physiology & chemistry6
Leaf c457 mg/g
Leaf dry-matter content (LDMC)212 mg/g
Leaf n33.03 mg/g
Leaf p1.49 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)27.49 mm²/mg
Other traits4
Diaspore typefruit
Leaf marginentire
Leaf spinesno
Leaf thornsno
03Chemical composition75 compounds
Compounds documented for Artemisia sieversiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Guaiane sesquiterpenoids18
Cinnamic acids and derivatives5
Furofuranoid lignans4
Germacrane sesquiterpenoids4
Simple coumarins4
Documented compounds75 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-(6S)-hydroxymenthol | present | NPASS | |
| (+)-Asarinin | present | LOTUS | |
| (+)-Demethoxyexcelsin | present | LOTUS | |
| (-)-alpha-Curcumene | present | LOTUS | |
| (1R,2R,5S,8S,9S,12S,13R,14S,15S,16S,17S,20S,21S,24S)-12,17-dihydroxy-3,8,12,17,21,25-hexamethyl-6,23-dioxaheptacyclo[13.9.2.01,16.02,14.04,13.05,9.020,24]hexacosa-3,25-diene-7,22-dione | present | LOTUS | |
| (1R,2S,3S,6S,7R,10S,11R,14S,15S,17S,20S,21S,24S)-3,24-dihydroxy-3,7,12,15,20,24-hexamethyl-9,18-dioxaheptacyclo[13.10.1.02,11.02,14.06,10.016,25.017,21]hexacosa-12,16(25)-diene-8,19-dione | present | LOTUS | |
| (1S,1'S,2S,2'S,5R,5'S,6S,6'S,9'S,10R,12R,12'R,14S)-2'-hydroxy-2',6',11',14-tetramethyl-9-methylidenespiro[3,13-dioxatetracyclo[8.4.0.02,6.012,14]tetradecane-5,14'-8-oxatetracyclo[10.2.1.01,10.05,9]pentadec-10-ene]-4,7'-dione | present | LOTUS | |
| (1S,2R,5S,8R,9S,12R,13R,14S,15S,16R,17S,20S,21S,24S)-12,17-dihydroxy-3,8,12,17,21,25-hexamethyl-6,23-dioxaheptacyclo[13.9.2.01,16.02,14.04,13.05,9.020,24]hexacosa-3,25-diene-7,22-dione | present | LOTUS | |
| (1S,2S,5R,6S,10R,12R,14S)-5,14-dimethyl-9-methylidene-3,13-dioxatetracyclo[8.4.0.02,6.012,14]tetradecan-4-one | present | LOTUS | |
| (1S,3S,9S,10R,12S,13S,16S,17R)-10-hydroxy-16-[(1R)-1-hydroxy-1-[(2S)-5-methyl-6-oxo-2,3-dihydropyran-2-yl]ethyl]-8,8,13,17-tetramethyl-7-oxapentacyclo[10.7.0.01,3.03,9.013,17]nonadec-4-en-6-one | present | NPASS |
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia sieversiana has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes5
GenBank sequences10
eDNA detections11
Countries5
The DNA barcodea real sequence read deposited for this species
ATCGTGTCGCCCCCCACAGTTCTCCGCAAAGGGAACTTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAA …
Artemisia sieversiana voucher ZX-1228 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Artemisia sieversiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–362n range18median18mode25records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1824×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · iapt
CCDB · ipcn-api-dl — Kaul, M. K. & S. K. Bakshi. 1984. Studies on the genus Artemsia L. in north-west Himalaya with particular reference to Kashmir. Folia Geobot. Phytotax. 19: 299–316.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Qiao, Y. m., X. x. Yan & S. z. Zhang. 1990. A study on the chromosomes of 20 species of the genus Artemisia. Grassl. China 1990(6): 24–31.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · ipcn-api-dl — Hu, T. m., R. Cao, H. p. Wang & S. z. Zhang. 1991. Studies on chromosomes of five species of Artemisia in Inner Mongolia. Acta Sci. Nat. Univ. Intramongol. 22(3): 422–427.
CCDB · ipcn-api-dl — Wang, C., G. b. Zhou, X. f. Xing & G. y. Zhang. 1998. Study on karyotypes of Artemisia sect. Absinthum DC. in northeast China. J. Wuhan Bot. Res. 16(1): 27–31.
CCDB · ipcn-api-dl — Gurzenkov, N. N. 1973. Studies of chromosome numbers of plants from the south of the Soviet Far East. Komarov Lectures. 20: 47–61.
CCDB · ipcn-api-dl — Vallès, J., M. Torrell, N. Garcia-Jacas & L. A. Kapustina. 2001. New or rare chromosome counts in the genera Artemisia L. and Mausolea Bunge (Asteraceae, Anthemideae) from Uzbekistan. Bot. J. Linn. Soc. 135(4): 391–400.
CCDB · ipcn-api-dl — Vallès, J. 2001. New or rare chromosome counts in Artemisia L. (Asteraceae, Anthemideae) and related genera from Kazakhstan. Bot. J. Linn. Soc. 137(4): 399–407.
CCDB · ipcn-api-dl — Volkova, S. A. & D. D. Basargin. 2002. Chromosome numbers of species of Chabarovsk territory flora. Bot. Žhurn. (Moscow & Leningrad) 87(4): 165–167.
CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.
CCDB · book-ipcn73-74 — BHAT, B.K.,. S.K. BAKSHI, I M.K. KAUL. 1974. In IOPB chromosome numbi reports XLVI. Taxon 23: 801-812.
CCDB · book-indian_vol1 — Kawatani, T. & Ohno, T. 1964 Chouksanova, N.A. et al. 1968a ; Bhat, B.K. et al. 1974b
CCDB · eflora
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · kew — Garcia S, Sanz M, Garnatje T et al. 2004. Variation of DNA amount in 47 populations of the subtribe Artemisiinae and related taxa (Asteraceae, Anthemideae): karyological, ecological, and systematic implications. Genome 47: 1004-1014.
CCDB · iapt — IAPT/IOPB Chromosome Data 23
CCDB · iapt — IAPT/IOPB Chromosome Data 30
CCDB · iapt — IAPT/IOPB Chromosome Data 32
CCDB · iapt — IAPT/IOPB Chromosome Data 35
2n 361×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Korobkov. 2003. Karyology of the genus Artemisia L. of Baical Siberia. Pages 303--305 in Botanical Study in Asiatic Russia. Vol. 1. Barnaul.
n 92×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 436 records
Wild obs. + sensor3 017
Museum / vouchered1 411
Other8
Origin
Native3
Introduced113
Range
Area of Occupancy AOO10 592 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy65% within 1 km
≤100 m 1 206≤1 km 228≤10 km 180>10 km 576
2 190 georeferenced · 827 without coordinates
Open the mapobservation + sensor3 017
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 18≤1 km 45≤10 km 47>10 km 23
133 georeferenced · 1 278 without coordinates
Open the institutions mapphysical evidence1 411
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions42 of 93 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 390 |
| Moscow State Universitylocation not on record | 189 |
| Yangling, CN | 124 |
| Xining, CN | 85 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 65 |
| Kunming, CN | 41 |
| Guangzhou, CN | 32 |
| Urumqi, CN | 32 |
| WNNUlocation not on record | 27 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 27 |
| Lanzhou, CN | 25 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 23 |
| Oulu, FI | 20 |
| Odawara, JP | 16 |
| Jiangxi College of Educationlocation not on record | 13 |
| Tsukuba, JP | 13 |
| Olocation not on record | 11 |
| Tianjin Natural History Museumlocation not on record | 10 |
| Inner Mongolia Universitylocation not on record | 10 |
| Chengdu, CN | 10 |
| Servico de Microbiologia e Imunologialocation not on record | 9 |
| Kyoto Universitylocation not on record | 9 |
| ENTClocation not on record | 9 |
| MeiseBGlocation not on record | 8 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 8 |
| Beijing, CN | 8 |
| IMMUlocation not on record | 7 |
| Taipei, TW | 7 |
| IWEP FEB RASlocation not on record | 7 |
| Shanxi Institute of Biologylocation not on record | 7 |
| Shinshu Universitylocation not on record | 6 |
| Tokushima, JP | 6 |
| Wuhan, CN | 6 |
| Turku, FI | 6 |
| Görlitz, DE | 5 |
| SXTCMlocation not on record | 5 |
| Nanjing, CN | 5 |
| Cambridge, US | 4 |
| SIHUlocation not on record | 4 |
| Chengdu, CN | 4 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Tomioka, JP | 4 |
| BRNUlocation not on record | 4 |
| Osaka, JP | 3 |
| Nanjing, CN | 3 |
| SABGlocation not on record | 3 |
| Beijing Natural History Museumlocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 2 |
| Uppsala, SE | 2 |
| Chicago, US | 2 |
| Wuhan, CN | 2 |
| Shenyang Agricultural Universitylocation not on record | 2 |
| Shanghai, CN | 2 |
| Shanghai, CN | 2 |
| Strecker Museum, Baylor Universitylocation not on record | 2 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| Guilin, CN | 2 |
| Kew, GB | 2 |
| Chiba, JP | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| WTUlocation not on record | 1 |
| PRClocation not on record | 1 |
| Bando, JP | 1 |
| Berlin, DE | 1 |
| Cambridge, US | 1 |
| Vancouver, CA | 1 |
| KURAlocation not on record | 1 |
| Bourges, FR | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Brussel, BE | 1 |
| Capital Normal Universitylocation not on record | 1 |
| KIWElocation not on record | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Awka, NG | 1 |
| Guangzhou, CN | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Minia, EG | 1 |
| Tromso University Museumlocation not on record | 1 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| South Kensington, GB | 1 |
| University of Stellenboschlocation not on record | 1 |
| Tibet Plateau Institute of Biologylocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Dehra Dun, IN | 1 |
93 institutions · 1 380 of 1 411 vouchered records shown · 30 without an institution code
09Environmental DNA11 detections
Where the DNA of Artemisia sieversiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map4 countries0
Pine Forest
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.0 °C 10.5–21.9
Seasonal swing summer↔winter24.5 °C
Max temp (day)22.4 °C 13.2–27.4
Min temp (night)12.5 °C 5.50–15.7
Precipitation58.6 mm/mo 32.4–264
Air humidity54.6 % 39.3–63.8
Moisture balance-80.6 mm/mo -153–174
Vapour deficit1,079 Pa 537–1,459
Wind speed4.00 m/s 3.20–4.50
Cloud cover34.3 % 25.2–42.7
CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.