Artemisia selengensis

Turcz. ex Besser · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records574

Data sources7

Biological traits19

DNA specimens2

eDNA detections1

Sources7 archives

Databases and archives Artemisia selengensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility574 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources19 traits

Chemical compositionNPASS42 compounds

Occurrence & distributionGBIF574 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Полин селенґінський — вид квіткових рослин з родини айстрових (Asteraceae). Поширення: Сибір, Монголія, Китай, Корея, Таїланд. Населяє береги річок і озер, вологі місця, луки, схили, узбіччя.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology8

Leaf length100 mm

Leaf length max120 mm

Leaf length min80 mm

Leaf width80 mm

Leaf width max100 mm

Leaf width min60 mm

Plant height max1.3 m

Plant height min0.75 m

Life cycle & reproduction3

Dispersal typewind

Life formperennial or rhizomatous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Growth formherb

Habitat GIFTburn clearings, forest, meadows: wet, rivers, sand, stony places

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition42 compounds

Compounds documented for Artemisia selengensis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quinolizidine alkaloids7

Serratane triterpenoids2

Ergostane steroids1

Epoxy fatty acids1

Terpenoid alkaloids1

Documented compounds42 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Lycopodine	present	NPASS
(1R,2R,13R,15R)-11-hydroxy-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadec-10-en-12-one	present	NPASS
(1R,9S,10R,16R)-14,16-dimethyl-6,14-diazatetracyclo[7.5.3.01,10.02,7]heptadeca-2(7),3,5-triene	present	NPASS
(2R,9S,11R,12R,14R,16S)-14-methyl-1,4-diazapentacyclo[7.7.1.02,12.03,8.011,16]heptadec-3(8)-en-5-one	present	NPASS
(3S,8S,9R,10R,13S,14S,17S)-17-[(2R,5R)-5,6-dimethylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(3S,9R,10S,13R,14S,17R)-17-[(E,2S,5R)-5,6-dimethylhept-3-en-2-yl]-10,13-dimethyl-2,3,4,9,11,12,14,15,16,17-decahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
[(1R,2R,10S,11R,13S,15R)-15-methyl-6-azatetracyclo[8.6.0.01,6.02,13]hexadecan-11-yl] acetate	present	NPASS
alpha-Obscurine	present	NPASS
AZBZYJLLVPEDIK-BBCLEEHXSA-N	present	NPASS
beta-Obscurine	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia selengensis has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences10

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV926489.1 ↗729 bpChina · 2013

ACGT

TCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGCGAACACGTAAAAACAACCGAGCGTCGGTCGGA …

Artemisia selengensis voucher KIOM201301006559 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL6★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type574 records

Wild obs. + sensor325

Museum / vouchered248

Cultivated / captive1

Range

Area of Occupancy AOO1 620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy26% within 1 km

≤100 m 32≤1 km 12≤10 km 67>10 km 60

171 georeferenced · 154 without coordinates

Open the mapobservation + sensor325

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤1 km 4≤10 km 12>10 km 2

18 georeferenced · 230 without coordinates

Open the institutions mapphysical evidence248

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institute of Applied Ecology, Academia Sinicalocation not on record	60
Beijing, CN	41
Moscow State Universitylocation not on record	30
Nanjing, CN	12
Guangzhou, CN	12
Yangling, CN	11
ENTClocation not on record	9
Herbarium of the Department of Botany, University of Tokyolocation not on record	9
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	7
Chengdu, CN	6
KR	6
National Institute of Biological Resourceslocation not on record	5
Odawara, JP	5
Natural History Museum Rotterdamlocation not on record	3
Taipei, TW	3
IWEP FEB RASlocation not on record	2
DMZ botanic gardenlocation not on record	2
Shenzhen, CN	2
JP	2
ifplocation not on record	2
Awka, NG	2
Jiangxi College of Educationlocation not on record	2
Institute of the biological problems of the North FEB RASlocation not on record	2
Wuhan, CN	1
Kew, GB	1
Kunming, CN	1
Changsha, CN	1
Guilin, CN	1
Beijing, CN	1
Strecker Museum, Baylor Universitylocation not on record	1
Santa Barbara, US	1
SIHUlocation not on record	1
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	1
Saint Louis, US	1
Barcelona, ES	1
University of Stellenboschlocation not on record	1

36 institutions · 248 of 248 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Artemisia selengensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)