Artemisia scoparia
Waldst. & Kit. · speciesAt a glance
Occurrence records4 853
Data sources11
Biological traits42
DNA specimens15
eDNA detections10
Sources11 archives
Databases and archives Artemisia scoparia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility4 853 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources42 traits
Chemical compositionLOTUS · NPASS163 compounds
Occurrence & distributionGBIF4 853 records
Environmental DNA1 datasets · 2 countries10 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB2n = 16
01Narrative
Bylica miotłowa – gatunek roślin z rodziny astrowatych. Występuje w niemal w całej Eurazji z wyjątkiem zachodnich i północnych krańców Europy oraz północno-wschodnich i południowych krańców Azji. Rośnie też w północno-wschodniej Afryce w Egipcie. Jako introdukowany obecny jest w Wielkiej Brytanii, na Archipelagu Malajskim, Półwyspie Indochińskim oraz w stanie Maryland w Ameryce Północnej. W Polsce uznawana jest za gatunek rodzimy na Lubelszczyźnie i wzdłuż środkowej i dolnej doliny Wisły. Poza tym występuje jako gatunek zawlekany na rozproszonych stanowiskach w całym kraju. Gatunek ekspansywny.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology8
Leaf size15 mm²
Plant height0.45 m
⚠ sources differ — GIFT: 0.45 m · LEDA: 0.45 m · TRY: 0.483 m
Plant height generative0.45 m
Plant height max0.7 m
Plant height min0.3 m
Seed mass35.41 mg
Seed mass max35.41 mg
Seed mass min35.41 mg
Life cycle & reproduction11
DeciduousnessN
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endAug
Flowering startAug
Life formannual, biennial or perennial
Life spanperennial
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 300 m
Elevation mean2 800 m
Elevation min600 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTcrop fields, desert, forest, meadows, mountains, old fields, rivers, sand, steppe
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio26.15 g/g
Leaf c457 mg/g
Leaf dry-matter content (LDMC)228 mg/g
Leaf n21.03 mg/g
Leaf p2.37 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)18.68 mm²/mg
Other traits4
Diaspore typefruit
Leaf margindissected
Leaf spinesno
Leaf thornsno
03Chemical composition163 compounds
Compounds documented for Artemisia scoparia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking
Compound class profile5 classes
Acyclic monoterpenoids19
Cinnamic acids and derivatives16
Menthane monoterpenoids $ Monocyclic monoterpenoids8
Aromadendrane sesquiterpenoids8
Flavonols8
Documented compounds163 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Thujan-3-ol | present | LOTUS | |
| (-)-2,6,6-Trimethyl-2(R)-vinyltetrahydropyran-5-one | present | NPASS | |
| (-)-alpha-Pinene | present | NPASS | |
| (-)-beta-Curcumene | present | NPASS | |
| (-)-beta-Pinene | present | NPASS | |
| (1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol | present | LOTUS | |
| (1R)-1-phenylhexa-2,4-diyn-1-ol | present | LOTUS | |
| (1R,3S,4S,5S)-3-((E)-3-(3,4-Dihydroxyphenyl)Acryloyloxy)-1,4,5-Trihydroxycyclohexanecarboxylic Acid | present | NPASS | |
| (1R,4S,6R,10S)-4,12,12-trimethyl-9-methylidene-5-oxatricyclo[8.2.0.04,6]dodecane | present | LOTUS | |
| (1R,9S)-4,11,11-trimethyl-8-methylene-bicyclo[7.2.0]undec-4-ene | present | NPASS |
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia scoparia has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes5
GenBank sequences10
eDNA detections10
Countries2
The DNA barcodea real sequence read deposited for this species
TTTATGCGAAAATACCCGTTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGG …
Artemisia scoparia isolate XB_HM2344 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Artemisia scoparia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidydiploid inferred
Chromosome records16–542n range16median16mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1625×CCDB · slov-fl · CCDB · iapt · CCDB · ipcn-api-dl +5
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · iapt
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Kaul, M. K. & S. K. Bakshi. 1984. Studies on the genus Artemsia L. in north-west Himalaya with particular reference to Kashmir. Folia Geobot. Phytotax. 19: 299–316.
CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1986. Chromosome numbers in some species of Asteraceae from the southern part of the Soviet far east. Bot. Zhurn. 71: 1693.
CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.
CCDB · ipcn-api-dl — Wang, L. s. 2000. Study on karyotypes of Artemisia sect. Drancunculus Bess. in northeast China. Bull. Bot. Res., Harbin 20(4): 402–407.
CCDB · ipcn-api-dl — Torrell, M., J. Vallès, N. Garcia-Jacas, V. Mozaffarian & E. Gabrielian. 2001. New or rare chromosome counts in the genus Artemisia L. (Asteraceae, Anthemideae) from Armenia and Iran. Bot. J. Linn. Soc. 135(1): 51–60.
CCDB · ipcn-api-dl — Vallès, J., M. Torrell, N. Garcia-Jacas & L. A. Kapustina. 2001. New or rare chromosome counts in the genera Artemisia L. and Mausolea Bunge (Asteraceae, Anthemideae) from Uzbekistan. Bot. J. Linn. Soc. 135(4): 391–400.
CCDB · ipcn-api-dl — HINDAKOVA, M. & J. Majovsky. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.
CCDB · ipcn-api-dl — Rotreklova. 2004. Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.
CCDB · book-ipcn67-71 — MURIN, A., & I.I. CHAUDHRI. 1970. In IOPB chromosome number reports XXVI. Taxon 19: 264-269. 70-322 NAG, K.K., & B.M. JOHRI. 1969. Organogenesis and chromosomal constitution in embryo callus of Nuytsia floribunda. Phytomorphology 19: 405-408.
CCDB · book-ipcn73-74 — PODLECH, D., & o. BADER. 1974. Chromosomenstudien an Afghanischen Pflanzen II. Mitt. Bot. Mtinchen 11; 457-488.
CCDB · book-indian_vol1 — Khoshoo, T.N. & Sobti, S.N. 1958; Chouksanova, N.A. et at. 1968a; Murin, A. & Chaudliri, I.l. 1970 ; Bhat, B.K. et al. 1974b
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · kew — Garcia S, Sanz M, Garnatje T et al. 2004. Variation of DNA amount in 47 populations of the subtribe Artemisiinae and related taxa (Asteraceae, Anthemideae): karyological, ecological, and systematic implications. Genome 47: 1004-1014.
CCDB · Cave1958 — Khoshoo & Sobti 19S8
CCDB · iapt — IAPT/IOPB Chromosome Data 23
CCDB · iapt — IAPT/IOPB Chromosome Data 26
CCDB · iapt — IAPT/IOPB Chromosome Data 32
CCDB · iapt — IAPT/IOPB Chromosome Data 35
2n 187×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-indian_vol1
CCDB · iapt
CCDB · ipcn-api-dl — Mendelak, M. & D. Schweizer. 1986. Giemsa C-banded karyotypes of some diploid Artemisia species. Pl. Syst. Evol. 152: 195–210.
CCDB · ipcn-api-dl — Qiao, Y. m., X. x. Yan & S. z. Zhang. 1990. A study on the chromosomes of 20 species of the genus Artemisia. Grassl. China 1990(6): 24–31.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · book-indian_vol1 — Mehra, P.N. & Remanandan, P. 1969
CCDB · iapt — IAPT/IOPB Chromosome Data 26
2n 541×CCDB · iapt
CCDB · iapt
n 82×CCDB · ipcn-api-dl · CCDB · Cave1958
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · Cave1958 — Khoshoo & Sobti 19S8
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type4 853 records
Wild obs. + sensor2 146
Museum / vouchered2 652
Other55
Origin
Native1
Introduced9
Range
Area of Occupancy AOO11 612 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy44% within 1 km
≤100 m 469≤1 km 110≤10 km 230>10 km 494
1 303 georeferenced · 843 without coordinates
Open the mapobservation + sensor2 146
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 87≤1 km 172≤10 km 259>10 km 104
622 georeferenced · 2 030 without coordinates
Open the institutions mapphysical evidence2 652
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions59 of 136 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 484 |
| Moscow State Universitylocation not on record | 406 |
| Yangling, CN | 202 |
| GMBAlocation not on record | 157 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 135 |
| BRNUlocation not on record | 132 |
| National Marine Biodiversity Institute of Korealocation not on record | 77 |
| Guangzhou, CN | 64 |
| Lanzhou, CN | 47 |
| Berlin, DE | 46 |
| Kunming, CN | 34 |
| Xining, CN | 30 |
| LDlocation not on record | 29 |
| Görlitz, DE | 29 |
| Chengdu, CN | 26 |
| Urumqi, CN | 26 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 26 |
| Chengdu, CN | 24 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 23 |
| WNNUlocation not on record | 21 |
| ENTClocation not on record | 21 |
| Servico de Microbiologia e Imunologialocation not on record | 20 |
| Nanjing, CN | 19 |
| GJOlocation not on record | 16 |
| Adam Mickiewicz University in Poznańlocation not on record | 16 |
| Inner Mongolia Universitylocation not on record | 16 |
| Jiangxi College of Educationlocation not on record | 16 |
| Guilin, CN | 15 |
| Seoul, KR | 12 |
| BFLlocation not on record | 12 |
| Beijing, CN | 11 |
| Central China Normal Universitylocation not on record | 11 |
| NSMKlocation not on record | 10 |
| Kyoto Universitylocation not on record | 9 |
| Wlocation not on record | 9 |
| Wuhan, CN | 9 |
| Oskarshamn, SE | 8 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 8 |
| Provincia di Livornolocation not on record | 8 |
| Mlocation not on record | 8 |
| IWEP FEB RASlocation not on record | 7 |
| PRClocation not on record | 7 |
| KR | 7 |
| Tokushima, JP | 6 |
| Shanxi Institute of Biologylocation not on record | 6 |
| Kew, GB | 6 |
| Hangzhou, CN | 6 |
| Zhejiang Museum of Natural Historylocation not on record | 5 |
| Nanjing, CN | 5 |
| Changsha, CN | 5 |
| Shanghai, CN | 5 |
| MeiseBGlocation not on record | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 4 |
| Uniwersytet Wrocławskilocation not on record | 4 |
| Xian, CN | 4 |
| Pullman, US | 4 |
| South Kensington, GB | 4 |
| Odawara, JP | 3 |
| SLU Artdatabankenlocation not on record | 3 |
| Yunnan Universitylocation not on record | 3 |
| Philadelphia, US | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Paris, FR | 3 |
| Northeastern Forestry Universitylocation not on record | 3 |
| Barcelona, ES | 3 |
| Helsinki, FI | 3 |
| LfUlocation not on record | 3 |
| IFR-DNFlocation not on record | 3 |
| Beijing Natural History Museumlocation not on record | 3 |
| GZUlocation not on record | 3 |
| Wuhan, CN | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Stockholm, SE | 2 |
| Cambridge, US | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 2 |
| Hazara Universitylocation not on record | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| FJFClocation not on record | 2 |
| WTUlocation not on record | 2 |
| Capital Normal Universitylocation not on record | 2 |
| ifplocation not on record | 2 |
| KIWElocation not on record | 2 |
| Guangzhou, CN | 2 |
| Bratislava, SK | 2 |
| MAlocation not on record | 2 |
| Shenyang Agricultural Universitylocation not on record | 2 |
| Xinxiang, CN | 2 |
| Awka, NG | 2 |
| Tsukuba, JP | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| BClocation not on record | 1 |
| Podgorica, ME | 1 |
| Salzburg, AT | 1 |
| Logan, US | 1 |
| Chongqing Museumlocation not on record | 1 |
| Frankfurt am Main | 1 |
| Dresden, DE | 1 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| AUAlocation not on record | 1 |
| Bronx, US | 1 |
| Cambridge, US | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| sonstHerblocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Xian, CN | 1 |
| SZUlocation not on record | 1 |
| Sion, CH | 1 |
| Bern, CH | 1 |
| Columbia, US | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Muzaffarabad, PK | 1 |
| Porvoo, FI | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Elocation not on record | 1 |
| Uppsala, SE | 1 |
| Zürich, CH | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| SABGlocation not on record | 1 |
| Brussel, BE | 1 |
| Otaru, JP | 1 |
| Fukushima Universitylocation not on record | 1 |
| Edinburgh, GB | 1 |
| Palacký University in Olomouclocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 1 |
136 institutions · 2 492 of 2 652 vouchered records shown · 159 without an institution code
09Environmental DNA10 detections
Where the DNA of Artemisia scoparia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found10
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 10 detections have coordinates
Open the map2 countries0
Desert
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median32.1 °C 24.4–32.1
Seasonal swing summer↔winter37.5 °C
Max temp (day)37.8 °C 29.5–37.8
Min temp (night)25.2 °C 17.0–25.2
Precipitation3.40 mm/mo 3.40–17.2
Air humidity36.8 % 35.5–36.8
Moisture balance-158 mm/mo -163–-158
Vapour deficit3,012 Pa 2,026–3,012
Wind speed2.30 m/s 2.30–3.50
Cloud cover25.4 % 24.3–25.4
CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.