Artemisia schmidtiana

Maxim. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records114

Data sources12

Biological traits11

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Artemisia schmidtiana's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility114 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionLOTUS · NPASS133 compounds

Occurrence & distributionGBIF114 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Artemisia schmidtiana, common name silvermound,Cornell University Growing Guide, Silvermound is a species of flowering plant in the family Asteraceae, native to Japan but widely cultivated as an ornamental.Maximowicz, Carl Johann. 1872. Bulletin de l'Academie Imperiale des Sciences de St-Petersbourg 17: 439-440 description + commentary in Latin

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology1

Plant height max0.6 m

Life cycle & reproduction4

Flowering endSep

Flowering startSep

Life formperennial

Life spanperennial

Diet & foraging1

Parasiteobligatory

Habitat & environment5

Climatetemperate

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains, sand, shores, stony places

Woodinessnon-woody

03Chemical composition133 compounds

Compounds documented for Artemisia schmidtiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cedrane and Isocedrane sesquiterpenoids13

Arylnaphthalene and aryltetralin lignans10

Norlabdane diterpenoids9

Germacrane sesquiterpenoids7

Pimarane and Isopimarane diterpenoids7

Documented compounds133 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-beta-Funebrene	present	LOTUS
(+)-Linalyl acetate	present	NPASS
(-)-Caryophyllene	present	LOTUS
(-)-Sandaracopimaric acid	present	NPASS
(-)-Savinin	present	NPASS
(1aS,4aR,8aR)-4a,8,8-trimethyl-1,1a,4,5,6,7-hexahydrocyclopropa[j]naphthalene-2-carboxylic acid	present	NPASS
(1beta,7beta)-Cedr-8(15)-ene	present	NPASS
(1E,6E)-gamma-humulene	present	LOTUS
(1R,2R,4aR,5S,8aR)-2-hydroxy-1,4a-dimethyl-6-methylidene-5-(3-oxobutyl)-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	NPASS
(1R,2R,4aR,5S,8aR)-2-hydroxy-5-(5-hydroxy-3-methylidene-4-oxopentyl)-1,4a-dimethyl-6-methylidene-3,4,5,7,8,8a-hexahydro-2H-naphthalene-1-carboxylic acid	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia schmidtiana has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences6

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ643032.1 ↗219 bp

ACGT

ATCGCGTCGCCCCCCACAGTTCTCCGCAAAGGGAACTTGTGTTTTGGGGGCGGATACTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAA …

Artemisia schmidtiana internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Artemisia schmidtiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1

CCDB · iapt — IAPT/IOPB Chromosome Data 13

CCDB · ipcn-api-dl — Nishikawa, T. 1985. Chromosome counts of flowering plants of Hokkaido (9). J. Hokkaido Univ. Educ., Sect. 2B 36: 25–40.

CCDB · book-ipcn67-71 — ARANO, H. 1968. The karyotypes and the geographical distribution in some groups of subfamily (Compositae) Of Japan. Kromosomo 72-73: 2371-2388.

CCDB · Cave1963 — Arano 1963d

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type114 records

Wild obs. + sensor58

Museum / vouchered53

Cultivated / captive3

Origin

Introduced1

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy24% within 1 km

≤100 m 13≤10 km 4>10 km 37

54 georeferenced · 4 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 1≤1 km 5≤10 km 7

13 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence53

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	13
WTUlocation not on record	5
Chiba, JP	4
SIHUlocation not on record	4
Moscow State Universitylocation not on record	3
KIRMlocation not on record	2
Oskarshamn, SE	2
Denver, US	2
J. Rusek Collectionlocation not on record	2
Chongqing Museumlocation not on record	2
Kushiro City Museumlocation not on record	2
Bronx, US	1
Odawara, JP	1
Otaru, JP	1
JP	1
Emporia, US	1
Hudson, US	1
Victoria, CA	1
Görlitz, DE	1
Auckland, NZ	1
Nagano City, JP	1
SLU Artdatabankenlocation not on record	1
Nishihara, JP	1

23 institutions · 53 of 53 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Artemisia schmidtiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)