Artemisia rupestris

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records2 952

Data sources9

Biological traits36

DNA specimens9

eDNA detections5

Sources9 archives

Databases and archives Artemisia rupestris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 952 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources36 traits

Chemical compositionNPASS44 compounds

Occurrence & distributionGBIF2 952 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

小银叶蒿（学名：）为菊科蒿属下的一个变种。

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology11

Leaf length22.5 mm

Leaf length max30 mm

Leaf length min15 mm

Leaf width15 mm

Leaf width max20 mm

Leaf width min10 mm

Plant height0.215 m

⚠ sources differ — GIFT: 0.215 m · LEDA: 0.215 m · TRY: 0.127 m

Plant height generative0.24 m

Plant height max0.5 m

Plant height min0.1 m

Seed mass0.095 mg

⚠ sources differ — TRY: 0.095 mg · LEDA: 0.042 mg · GIFT: 0.042 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeanimal

⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous

Flowering endAug

Flowering startAug

Life formperennial

Life spanpoly-annuals 5-50 years (medium-lived perennials)

⚠ sources differ — TRY: poly-annuals 5-50 years (medium-lived perennials) · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formchamaephyte

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment11

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Elevation max4 300 m

Elevation mean2 000 m

Elevation min1 100 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, limestone, meadows, steppe, stony places

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)157 mg/g

Photosynthetic pathwayC3

Other traits1

Diaspore typegenerative dispersule

03Chemical composition44 compounds

Compounds documented for Artemisia rupestris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones7

Guaiane sesquiterpenoids5

Cinnamic acids and derivatives3

Flavonols2

Iridoids monoterpenoids2

Documented compounds44 total

Tissue Source Quantified only

Compound	Amount	Source
(1S,4aS,5R,7S,7aR)-5-hydroxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid	present	NPASS
(1S,4aS,5S,7S,7aR)-5-hydroxy-7-methyl-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6,7,7a-hexahydrocyclopenta[c]pyran-4-carboxylic acid	present	NPASS
(5R,8S,8aS)-3,8-dimethyl-2-oxo-4,5,6,7,8,8a-hexahydro-1H-azulene-5-carboxylic acid	present	NPASS
2-[(1R,4S,5S)-5-methyl-3-oxo-4-(3-oxobutyl)cycloheptyl]prop-2-enoic acid	present	NPASS
2-[(3aS,5R,8S,8aR)-3a-hydroxy-3,8-dimethyl-1-oxo-4,5,6,7,8,8a-hexahydroazulen-5-yl]prop-2-enoic acid	present	NPASS
2-[(3R,5R,8S)-3-hydroxy-3,8-dimethyl-1-oxo-2,4,5,6,7,8-hexahydroazulen-5-yl]prop-2-enoic acid	present	NPASS
2-[(3S,3aR,5R,8S,8aS)-3,3a-dihydroxy-3,8-dimethyl-1,2,4,5,6,7,8,8a-octahydroazulen-5-yl]prop-2-enoic acid	present	NPASS
2-[(5R,8S,8aR)-8-hydroxy-3,8-dimethyl-2-oxo-1,4,5,6,7,8a-hexahydroazulen-5-yl]prop-2-enoic acid	present	NPASS
2-[(5R,8S,8aR)-8a-hydroxy-3,8-dimethyl-2-oxo-1,4,5,6,7,8-hexahydroazulen-5-yl]prop-2-enoic acid	present	NPASS
2-[(5R,8S,8aS)-8a-hydroxy-3,8-dimethyl-2-oxo-1,4,5,6,7,8-hexahydroazulen-5-yl]prop-2-enoic acid	present	NPASS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia rupestris has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences10

eDNA detections5

Countries3

The DNA barcodea real sequence read deposited for this species

ITSMG219574.1 ↗221 bpCanada · 2003

ACGT

GCCCCCCACAGTTCTCCGCAAAGGGAACTTGTGTTTTGGGGGCGGATACTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAAATAGGAGT …

Artemisia rupestris voucher BAB-3627 internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★rbcLa★ITS4★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type2 952 records

Wild obs. + sensor2 335

Museum / vouchered614

Cultivated / captive2

Other1

Origin

Native2

Introduced2

Range

Area of Occupancy AOO3 804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 1 509≤1 km 311≤10 km 60>10 km 289

2 169 georeferenced · 166 without coordinates

Open the mapobservation + sensor2 335

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 21≤1 km 24≤10 km 197>10 km 31

273 georeferenced · 341 without coordinates

Open the institutions mapphysical evidence614

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 40 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	129
Moscow State Universitylocation not on record	75
Tartu, EE	72
Uppsala, SE	68
Oskarshamn, SE	67
GMBAlocation not on record	34
Tallinn, EE	26
SLU Artdatabankenlocation not on record	17
GZUlocation not on record	14
Beijing, CN	14
Urumqi, CN	10
Görlitz, DE	10
BRNUlocation not on record	9
Olocation not on record	8
Institute of Applied Ecology, Academia Sinicalocation not on record	6
Philadelphia, US	4
Stockholm, SE	3
Research Collection of B. A. Bennettlocation not on record	3
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	3
Dresden, DE	3
Wlocation not on record	3
Xining, CN	2
Chengdu, CN	2
Xian, CN	2
Kunming, CN	2
Saint Louis, US	2
Davis, US	1
Minia, EG	1
Auckland, NZ	1
Denver, US	1
NMBU:MINAlocation not on record	1
Vancouver, CA	1
Edinburgh, GB	1
Shanghai, CN	1
Helsinki, FI	1
Zürich, CH	1
Yangling, CN	1
Berlin, DE	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Trondheim, NO	1

40 institutions · 602 of 614 vouchered records shown · 11 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Artemisia rupestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

Base of cliff in rocky soil with Calamagrost…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.60 °C 0–14.0

Seasonal swing summer↔winter28.4 °C

Max temp (day)12.9 °C 3.60–17.7

Min temp (night)4.70 °C -4.80–9.20

Precipitation48.0 mm/mo 28.3–59.4

Air humidity56.0 % 55.2–59.4

Moisture balance-77.5 mm/mo -82.5–-30.3

Vapour deficit551 Pa 370–717

Wind speed4.00 m/s 2.70–4.10

Cloud cover43.1 % 42.3–53.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Artemisia rupestris

At a glance

Sources9 archives

Size & morphology11

Life cycle & reproduction10

Diet & foraging1

Habitat & environment11

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds44 total

At a glance

Record type2 952 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions27 of 40 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 952 records