Artemisia palmeri

A.Gray · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records1 010

Data sources10

Biological traits10

DNA specimens5

eDNA detections3

Sources10 archives

Databases and archives Artemisia palmeri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 010 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF1 010 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB · GoaT3.5 Gbp

01Narrative

Artemisia palmeri is a rare species of sagebrush known by the common names San Diego sagewort and Palmer sagewort.Calflora taxon report, University of California, Artemisia palmeri A. Gray San Diego sage, San Diego sagewort United States Department of Agriculture Plants ProfileFlora of North America Vol. 19, 20 and 21 Page 531, Palmer sagewort, Artemisia palmeri A. Gray, Proc. Amer. Acad. Arts. 11: 79. 1876.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology3

Seed mass0.061 mg

Seed mass max0.06 mg

Seed mass min0.06 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia palmeri has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences7

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF504151.1 ↗218 bp

ACGT

ATCGCGTCGCCCCCCACAATTCTTCGCAAAGAGAACTTGTGCTTTGGGGGCGGATATTGGTCTCCCGTGCGCATGGCGTGGTTGGCCGAA …

Artemisia palmeri internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Artemisia palmeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 491 460 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Artemisia palmeri3.49 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–182n range18median18mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 187×GoaT · Kew Plant DNA C-values Database · CCDB · eflora · CCDB · book-atlas-flowering-plants

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · eflora

CCDB · book-atlas-flowering-plants — Ward 1953

CCDB · book-atlas-flowering-plants — Suzuka 1950b, 1951

CCDB · book-atlas-flowering-plants — Clausen et al. '40a, b

CCDB · book-atlas-flowering-plants — Nygren, L. &. L. '48

CCDB · book-atlas-flowering-plants — Favarger 1953

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 010 records

Wild obs. + sensor804

Museum / vouchered206

Origin

Introduced1

Range

Area of Occupancy AOO1 040 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 542≤1 km 57≤10 km 13>10 km 14

626 georeferenced · 178 without coordinates

Open the mapobservation + sensor804

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 37≤1 km 15≤10 km 37>10 km 1

90 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence206

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Diego, US	104
Claremont, US	23
Riverside, US	21
Severin-McDaniel Insect Collectionlocation not on record	16
CASlocation not on record	4
Austin, US	4
University of Stellenboschlocation not on record	4
Irvine, US	3
Phoenix, US	3
Saint Louis, US	3
Santa Barbara, US	3
Los Angeles, US	3
Ensenada, MX	2
Lubbock, US	2
La Paz, MX	1
Henderson, US	1
Philadelphia, US	1
Moscow, US	1
Arizona State University Biocollectionslocation not on record	1
The University of Arizonalocation not on record	1
GB	1
ASUlocation not on record	1
University of Alberta Museumslocation not on record	1

23 institutions · 204 of 206 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Artemisia palmeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

Coastal riparian

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Artemisia palmeri

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 010 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 010 records