Artemisia mesatlantica

Maire · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records0

Data sources7

Biological traits0

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Artemisia mesatlantica's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS19 compounds

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 18

01Narrative

Artemisia mesatlantica est une espèce de plantes à fleurs de la famille des Asteracées, endémique du Maroc. Une étude a démontré les propriétés antibactérienne et antifongique de son huile essentielle, composée principalement de β-thuyone, de camphène et de camphre (4,17%).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition19 compounds

Compounds documented for Artemisia mesatlantica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavones8

Flavonols5

Guaiane sesquiterpenoids3

Simple coumarins3

Miscellaneous polyketides1

Documented compounds19 total

Tissue Source Quantified only

Compound	Amount	Source
(3aS,9aR,9bR)-6,9a-dimethyl-3-methylidene-3a,4,5,9b-tetrahydroazuleno[8,7-b]furan-2,9-dione	present	LOTUS
(3E,4S)-3-decylidene-4-hydroxy-5-methylideneoxolan-2-one	present	NPASS
2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-4-oxo-4H-1-benzopyran-3-yl 6-deoxyhexopyranoside	present	LOTUS
5,4'-Dihidroxy-6,7,3',5'-tetramethoxyflavone	present	LOTUS
5,7,4'-Trihydroxy-6,3',5'-trimethoxyflavone	present	LOTUS
6,7-dimethoxy-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-2-one	present	NPASS
6-Hydroxyluteolin 6,7,3',4'-tetramethyl ether	present	LOTUS
Afzelin	present	NPASS
Apigenin	present	LOTUS
Chrysoeriol	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia mesatlantica has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJX051749.1 ↗641 bpMorocco

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGCGAACACGTAAAAACAACCGAGTGCCGATTGGATCAAGCGCTTGTTTGATCCTCTCGACGCTT …

Artemisia mesatlantica internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Artemisia mesatlantica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ouyahya, A. & J. Viano. 1988. Recherches cytogénétiques sur le genre Artemisia L. au Maroc. Bol. Soc. Brot., sér. 2 61: 105–124.

CCDB · ipcn-api-dl — Duyahya, J. V. 1981. Caryologie de taxons endemiques marrocans du genere Artemisia L. Bol. Soc. Brot. 53: 907–919.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)