Artemisia longifolia

Nutt. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records2 235

Data sources11

Biological traits8

DNA specimens5

eDNA detections3

Sources11 archives

Databases and archives Artemisia longifolia's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 235 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources8 traits

Occurrence & distributionGBIF2 235 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 36

01Narrative

Artemisia longifolia is North American species in the daisy family, known by the common name long-leaved sage or longleaf wormwood. It is native to western Canada (Manitoba, Saskatchewan, Alberta, British Columbia) and the north-central United States (Montana, the Dakotas, Minnesota, Wyoming, and Colorado with a few isolated populations in Oklahoma).Biota of North America Program 2014 county distribution map Artemisia longifolia is a perennial up to 80 cm (32 inches) tall, usually not forming clumps. Leaves are longer and narrower than for most related species, up to 12 cm (5 inches) long. The species grows in barren areas, in grasslands, and in alkaline flats in the high plains.Flora of North America, Long-leaved sage, Artemisia longifolia

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia longifolia has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences4

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJN861942.1 ↗218 bpUSA

ACGT

ATCGCGTCGCCCCCCACAATTCTCCGCAAGAGAACTTGTGCTTTGGGGGCGGATATTGGTCTCCCGCGCTCATGGCGTGGTTGGCCGAAA …

Artemisia longifolia isolate CR205 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Artemisia longifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records36–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 363×CCDB · ipcn-api-dl · CCDB · eflora

CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.

CCDB · ipcn-api-dl — Stahevitch, A. E. & W. A. Wojtas. 1988. Chromosome numbers of some North American species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672–676.

CCDB · eflora

n 182×CCDB · ipcn-api-dl · CCDB · Cave1956supp

CCDB · ipcn-api-dl — Stahevitch, A. E. & W. A. Wojtas. 1988. Chromosome numbers of some North American species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672–676.

CCDB · Cave1956supp — Keck 1946

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 235 records

Wild obs. + sensor2 068

Museum / vouchered167

Origin

Native6

Range

Area of Occupancy AOO1 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 684≤1 km 254≤10 km 11>10 km 16

1 965 georeferenced · 103 without coordinates

Open the mapobservation + sensor2 068

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 2≤1 km 12≤10 km 56>10 km 11

81 georeferenced · 86 without coordinates

Open the institutions mapphysical evidence167

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wuzhou, CN	24
Vancouver, CA	17
DOI/NPS, Colonial National Historical Parklocation not on record	16
Bronx, US	15
Spearfish, US	15
University of Alberta Museumslocation not on record	12
Bozeman, US	11
Missoula, US	10
WINlocation not on record	7
Chadron, US	6
Provo, US	4
Musee des Dinosaures d'Esperaza (Aude)location not on record	3
Logan, US	3
Research Collection of B. A. Bennettlocation not on record	2
Riverside, US	2
Saint Louis, US	2
Pullman, US	2
Chongqing Museumlocation not on record	2
AUAlocation not on record	2
DOI/NPS, Greenbelt Parklocation not on record	2
Whitehorse, CA	1
Moscow, US	1
Bloomington, US	1

23 institutions · 160 of 167 vouchered records shown · 7 without an institution code

09Environmental DNA3 detections

Where the DNA of Artemisia longifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Codominant on dry grassland dominated by Fes…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 15.6–17.8

Seasonal swing summer↔winter29.3 °C

Max temp (day)23.0 °C 22.1–23.8

Min temp (night)11.3 °C 10.1–12.5

Precipitation68.9 mm/mo 66.1–71.7

Air humidity54.6 % 54.4–54.9

Moisture balance-68.9 mm/mo -70.1–-67.7

Vapour deficit867 Pa 811–923

Wind speed3.40 m/s 3.20–3.60

Cloud cover39.7 % 37.4–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Artemisia longifolia

At a glance

Sources11 archives

Life cycle & reproduction1

Diet & foraging1

Habitat & environment5

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 235 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 235 records