Artemisia laciniata

Willd. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records1 107

Data sources12

Biological traits26

DNA specimens11

eDNA detections6

Sources12 archives

Databases and archives Artemisia laciniata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 107 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources26 traits

Chemical compositionLOTUS · NPASS123 compounds

Occurrence & distributionGBIF1 107 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI11 specimens

Genome at a glanceCCDB2n = 18

01Narrative

구와쑥은 국화과에 속하는 여러해살이풀이다. 한국 원산이다.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Plant height0.21 m

Plant height generative0.3 m

Plant height max0.9 m

Plant height min0.1 m

Seed mass0.259 mg

Life cycle & reproduction10

Deciduousnessevergreen

Dispersal typeanimal

⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous

Flowering endAug

Flowering startAug

Life formperennial or rhizomatous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formchamaephyte

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTarctic, forest, rivers, tundra

Woodinessnon-woody

Physiology & chemistry2

Leaf dry-matter content (LDMC)230 mg/g

Photosynthetic pathwayC3

Other traits1

Diaspore typefruit

03Chemical composition123 compounds

Compounds documented for Artemisia laciniata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple coumarins16

Silphiperfolane sesquiterpenoids5

Dicarboxylic acids3

Fatty alcohols1

Eremophilane sesquiterpenoids1

Documented compounds123 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,2R,5S,6S,8S,9R)-2,3,5,9-tetramethyltricyclo[6.3.0.01,5]undec-3-en-6-ol	present	LOTUS
(1R,2R,5S,8S,9R)-2,3,5,9-tetramethyltricyclo[6.3.0.01,5]undec-3-en-6-one	present	LOTUS
(1R,2S,5S,6S,8S,9R)-2,3,5,9-tetramethyltricyclo[6.3.0.01,5]undec-3-en-6-ol	present	LOTUS
(1R,2S,5S,8S,9R)-2,3,5,9-tetramethyltricyclo[6.3.0.01,5]undec-3-en-6-one	present	LOTUS
(1R,5S,8S,9R)-2,3,5,9-tetramethyltricyclo[6.3.0.01,5]undec-2-ene-4,6-dione	present	LOTUS
(1S,2R,4S)-1-(hydroxymethyl)-7,7-dimethylbicyclo[2.2.1]heptan-2-ol	present	LOTUS
(2E,6R)-6-hydroxyocta-2,7-dien-4-one	present	LOTUS
(3S,5R,7R,8R,9S,10S,13S,14S)-3,7-Dihydroxy-10,13-Dimethyl-1,2,3,4,5,6,7,8,9,11,12,14,15,16-Tetradecahydrocyclopenta[A]Phenanthren-17-One	present	NPASS
(3S,5R,8R,9S,10S,13S,14S)-3-Hydroxy-10,13-Dimethyl-2,3,4,5,6,8,9,11,12,14,15,16-Dodecahydro-1H-Cyclopenta[A]Phenanthrene-7,17-Dione	present	NPASS
(S)-2,6,6-Trimethyl-2-((2S,5R)-5-methyl-5-vinyltetrahydrofuran-2-yl)-2H-pyran-3(6H)-one	present	LOTUS

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia laciniata has left across the world's sequence archives.

At a glance

DNA specimens11

Marker genes5

GenBank sequences10

eDNA detections6

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMT271738.1 ↗309 bpMongolia

ACGT

TCTCGACGCTTTGTCGATGCGCATTTACTCGTGTTCTTTAGGACCTTGTGAATGTGTCATTGGCGCATTAACAACCCCCGGCACAATGTG …

Artemisia laciniata internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Artemisia laciniata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–362n range18median18mode22records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1820×CCDB · iapt · CCDB · fl-europaea · CCDB · book-ipcn65 +3

CCDB · iapt — IAPT/IOPB Chromosome Data 10

CCDB · iapt

CCDB · fl-europaea — Ehrendorfer, 1964

CCDB · book-ipcn65 — Koul 1963-64c

CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1985. Chromosome numbers in some species of the family Asteraceae from the southernpart of the Soviet Far East. Bot. Zhurn. SSSR 70(7): 1000–1001. (In Russian).

CCDB · ipcn-api-dl — Kaul, M. K. & S. K. Bakshi. 1984. Studies on the genus Artemsia L. in north-west Himalaya with particular reference to Kashmir. Folia Geobot. Phytotax. 19: 299–316.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.

CCDB · ipcn-api-dl — Nishikawa, T. 1990. Chromosome counts of flowering plants of Hokkaido (13). J. Hokkaido Univ. Educ., Sect. 2B 40: 19–30.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.

CCDB · ipcn-api-dl — Krasnikov. 2006. Chromosome numbers of some Artemisia species (Asteraceae) from Siberia. Bot. Žhurn. (Moscow & Leningrad) 91(3): 481–482.

CCDB · ipcn-api-dl — Probatova, N. S. 2000. Chromosome numbers in some plant species from the Razdolnaya (Suifun) river basin (Primorsky Territory). Bot. Žhurn. (Moscow & Leningrad) 85(12): 102–107.

CCDB · ipcn-api-dl — Korobkov. 2003. Karyology of the genus Artemisia L. of Baical Siberia. Pages 303--305 in Botanical Study in Asiatic Russia. Vol. 1. Barnaul.

CCDB · book-indian_vol1 — Suzuka, O. 1950b, 1952 ; Khoshoo, T.N. & Sobti, S.N. 1958; Ehrendorfer, F. 1964 ; Kawatani, T. & Ohno, T. 1964 ; Koul, M.L.H. 1964d

CCDB · iapt — IAPT/IOPB Chromosome Data 17

CCDB · Cave1958 — Khoshoo & Sobti 1958

CCDB · iapt — IAPT/IOPB Chromosome Data 19

CCDB · iapt — IAPT/IOPB Chromosome Data 20

CCDB · iapt — IAPT/IOPB Chromosome Data 23

2n 362×CCDB · ipcn-api-dl · CCDB · iapt

CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.

CCDB · iapt — IAPT/IOPB Chromosome Data 23

n 91×CCDB · book-ipcn65

CCDB · book-ipcn65 — Koul 1963-64c

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 107 records

Wild obs. + sensor749

Museum / vouchered354

Cultivated / captive1

Other3

Origin

Native1

Introduced1

Range

Area of Occupancy AOO3 584 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 110≤1 km 28≤10 km 46>10 km 460

644 georeferenced · 105 without coordinates

Open the mapobservation + sensor749

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 2≤1 km 15≤10 km 128>10 km 12

157 georeferenced · 197 without coordinates

Open the institutions mapphysical evidence354

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 44 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	130
Uppsala, SE	62
Tsukuba, JP	28
BRNUlocation not on record	12
QAUlocation not on record	8
Beijing, CN	8
Provincia di Livornolocation not on record	8
Inner Mongolia Universitylocation not on record	8
Whitehorse, CA	7
Yangling, CN	7
Vancouver, CA	6
GZUlocation not on record	5
Görlitz, DE	5
Wlocation not on record	5
WTUlocation not on record	4
Research Collection of B. A. Bennettlocation not on record	3
ENTClocation not on record	3
Peking Universitylocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
GJOlocation not on record	2
Hokkaido University Museumlocation not on record	2
University of Stellenboschlocation not on record	2
DOI/NPS, Colonial National Historical Parklocation not on record	2
Nanjing, CN	2
Chengdu, CN	2
Stockholm, SE	1
Anchorage, US	1
Yukon Universitylocation not on record	1
València, ES	1
Zürich, CH	1
Saint Louis, US	1
Frankfurt am Main	1
Dresden, DE	1
Guangzhou, CN	1
Tianjin Natural History Museumlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
IWEP FEB RASlocation not on record	1
LDlocation not on record	1
University of Alberta Museumslocation not on record	1
SCAUlocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Institute of the biological problems of the North FEB RASlocation not on record	1
Helsinki, FI	1
Servico de Microbiologia e Imunologialocation not on record	1

44 institutions · 344 of 354 vouchered records shown · 10 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Artemisia laciniata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.8 °C 14.8–15.9

Seasonal swing summer↔winter36.4 °C

Max temp (day)19.2 °C 19.2–20.4

Min temp (night)8.70 °C 8.70–10.2

Precipitation55.5 mm/mo 55.5–78.0

Air humidity51.5 % 51.5–52.9

Moisture balance-69.3 mm/mo -69.3–-39.5

Vapour deficit817 Pa 817–854

Wind speed2.00 m/s 1.60–2.00

Cloud cover42.5 % 42.5–44.5

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Artemisia laciniata

At a glance

Sources12 archives

Size & morphology5

Life cycle & reproduction10

Diet & foraging1

Habitat & environment7

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds123 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 107 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions18 of 44 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 107 records