Artemisia japonica
Thunb. · speciesAt a glance
Occurrence records3 924
Data sources11
Biological traits29
DNA specimens4
eDNA detections4
Sources11 archives
Databases and archives Artemisia japonica's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 924 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics4 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources29 traits
Chemical compositionLOTUS · NPASS18 compounds
Occurrence & distributionGBIF3 924 records
Environmental DNA1 datasets · 0 countries4 detections
DNA & barcodingBOLD · NCBI4 specimens
Genome at a glanceCCDB2n = 36
01Narrative
Artemisia japonica — вид квіткових рослин з родини айстрових (Asteraceae). Поширення: Сибір, Китай, Афганістан, Бутан, пн. Індія, Японія, Корея, Лаос, М'янма, Непал, Пакистан, Філіппіни, Таїланд, В'єтнам. Населяє лісові узлісся, пустирі, чагарники, пагорби, схили, узбіччя доріг; від низьких висот до 3300 м.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology12
Leaf length50 mm
Leaf length max60 mm
Leaf length min40 mm
Leaf width22.5 mm
Leaf width max25 mm
Leaf width min20 mm
Plant height1.5 m
Plant height max0.9 m
Plant height min0.65 m
Seed mass0.06 mg
Seed mass max0.06 mg
Seed mass min0.06 mg
Life cycle & reproduction6
Flowering endAug
Flowering startAug
Life formperennial
Life spanperennial
Lifespan years1 years
Raunkiær life formhemicryptophyte
Diet & foraging1
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min2 000 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, meadows, mountains, rivers, shrubberies
Woodinessnon-woody
Physiology & chemistry1
Photosynthetic pathwayC3
03Chemical composition18 compounds
Compounds documented for Artemisia japonica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Eudesmane sesquiterpenoids3
Eremophilane sesquiterpenoids2
Cinnamic acids and derivatives $ Simple phenolic acids1
Humulane sesquiterpenoids1
Farnesane sesquiterpenoids1
Documented compounds18 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,4R,4aS,8aS)-4,8a-dimethyl-6-propan-2-yl-1,2,3,4a,5,8-hexahydronaphthalene-1,4-diol | present | LOTUS | |
| (4-Acetyloxyphenyl)Methyl Acetate | present | NPASS | |
| 3,3,6-Trimethyl-1,5-heptadien-4-ol | present | LOTUS | |
| 4'-Hydroxyacetophenone | present | LOTUS | |
| [(4S,4aS,5R,6S,8aR)-3,4a,5-trimethyl-4-(2-methylprop-2-enoyloxy)-5,6,7,8,8a,9-hexahydro-4H-benzo[f][1]benzofuran-6-yl] (3R)-3-hydroxypent-4-enoate | present | NPASS | |
| [(4S,4aS,5R,6S,8aR)-4-hydroxy-3,4a,5-trimethyl-5,6,7,8,8a,9-hexahydro-4H-benzo[f][1]benzofuran-6-yl] 2-methylprop-2-enoate | present | NPASS | |
| Eugenol | present | LOTUS | |
| Farnesol acetate | present | NPASS | |
| KABGCWRGCBCLOH-YFVJAWDISA-N | present | NPASS | |
| L-Coprine | present | NPASS |
05DNA & barcoding4 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia japonica has left across the world's sequence archives.
At a glance
DNA specimens4
Marker genes2
GenBank sequences10
eDNA detections4
Countries2
The DNA barcodea real sequence read deposited for this species
ATCGCGTCGCCCCCCACAGTTCTCCGTTAGGGGAGCTTGTGTTTTGGGGGCGGATACTGGTCTCCCGTGCTCATGGCGCGGTTGGCCGAA …
Artemisia japonica isolate CL2021-2024 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★ITS9
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Artemisia japonica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidypolyploid inferred
Chromosome records18–362n range36median36mode20records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3614×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol1 +2
CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1986. Chromosome numbers in some species of Asteraceae from the southern part of the Soviet far east. Bot. Zhurn. 71: 1693.
CCDB · ipcn-api-dl — Nishikawa, T. 1988. Chromosome counts of flowering plants of Hokkaido (11). J. Hokkaido Univ. Educ., Sect. 2B 38: 33–40.
CCDB · ipcn-api-dl — Kawano, S., Y. Nagai & S. Hoshiya-Ushida. 1995. A study on the natural hybrid swarms of two Artemisia species, A. capillaris and A. japonica (Compositae) in Central Honshu, Japan, with special reference to its biological status. J. Phytogeogr. Taxon. 42: 133–153.
CCDB · ipcn-api-dl — Wang, C., L. s. Wang, Y. Guan & G. y. Zhang. 2000. Study on karyotypes of Artemisia sect. Latilobus Y. R. Ling in northeast China. J. Wuhan Bot. Res. 18(3): 244–246.
CCDB · ipcn-api-dl — MASUMORI, S. 1977. Karyotype analysis on Artemisia japonica and A. stolonifera. Bull. Fac. Educ. Yamaguchi Univ. 26: 77–84.
CCDB · ipcn-api-dl — Taniguchi, K., R. Tanaka, Y. Yonezawa & H. KOMATSU. 1975. Types of banding patterns of plant chromosomes by modified BSG method. Kromosomo, II 100: 3123–3135.
CCDB · ipcn-api-dl — Hoshi, Y., K. Kondo, A. A. Korobkov, I. V. Tatarenko, P. V. Kulikov, V. P. Verkholat, A. Gontcharov, H. Ogura, T. Finamoto, G. Kokubugata, R. Suzuki & H. Matoba. 2004. Cytological study in the genus Artemisia L. (Asteraceae) from Russia. Chromosome Sci. 7: 83–89.
CCDB · ipcn-api-dl — Xiong, X., Y. r. Ling & L. Jiang. 1995. Studies on the chromosome numbers and karyotype of six species of Artemisia (Compositae). J. Trop. & Subtrop. Bot. 3(3): 23–29.
CCDB · book-ipcn67-71 — ARANO, H. 1968. The karyotypes and the geographical distribution in some groups of subfamily (Compositae) Of Japan. Kromosomo 72-73: 2371-2388.
CCDB · book-indian_vol1 — Shimotomai, N. 1947a ; Suzuka, 0, 1950b, 1952 ; Arano, H. 1962c, 1968 ; Kawatani, T. & Ohno, T. 1964
CCDB · book-indian_vol1 — Shimotomai, N. 1947a (Kitamura, S. 1957)
CCDB · book-indian_vol1 — Mehra, P.N. & Remanandan, P. 1969
CCDB · book-atlas-flowering-plants — Suzuka 1950b
CCDB · Cave1962 — Arano 1962c
2n 186×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · Cave1958
CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1985. Chromosome numbers in some species of the family Asteraceae from the southernpart of the Soviet Far East. Bot. Zhurn. SSSR 70(7): 1000–1001. (In Russian).
CCDB · ipcn-api-dl — Xiong, X., Y. r. Ling & L. Jiang. 1995. Studies on the chromosome numbers and karyotype of six species of Artemisia (Compositae). J. Trop. & Subtrop. Bot. 3(3): 23–29.
CCDB · ipcn-api-dl — Kaul, M. K. & S. K. Bakshi. 1984. Studies on the genus Artemsia L. in north-west Himalaya with particular reference to Kashmir. Folia Geobot. Phytotax. 19: 299–316.
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · book-indian_vol1 — Khoshoo, T.N. & Sobti, S.N. 1958 ; Koul, M.L.H. 1964d
CCDB · Cave1958 — Khoshoo & Sobti 1958
n 93×CCDB · ipcn-api-dl · CCDB · Cave1958
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · Cave1958 — Khoshoo & Sobti 1958
n 181×CCDB · book-ipcn67-71
CCDB · book-ipcn67-71 — MEHRA, P.N., & P. REMANANDAN. 1969. In IOPB chromosome number repoI XXII. Taxon 18: 433-442.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 924 records
Wild obs. + sensor1 227
Museum / vouchered2 696
Other1
Origin
Native8
Range
Area of Occupancy AOO8 736 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy24% within 1 km
≤100 m 41≤1 km 10≤10 km 64>10 km 96
211 georeferenced · 1 016 without coordinates
Open the mapobservation + sensor1 227
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy19% within 1 km
≤100 m 4≤1 km 23≤10 km 114>10 km 1
142 georeferenced · 2 554 without coordinates
Open the institutions mapphysical evidence2 696
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions70 of 126 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 363 |
| Yangling, CN | 226 |
| Guangzhou, CN | 148 |
| Chengdu, CN | 130 |
| Odawara, JP | 123 |
| Kunming, CN | 111 |
| Nagano City, JP | 101 |
| Shinshu Universitylocation not on record | 75 |
| Tokushima, JP | 66 |
| Nanjing, CN | 66 |
| Wuhan, CN | 65 |
| Chiba, JP | 63 |
| Guilin, CN | 55 |
| Bando, JP | 53 |
| Nagatoro-machi, Chichibu-gun, JP | 41 |
| Tsukuba, JP | 37 |
| Toyama, JP | 37 |
| NSMKlocation not on record | 36 |
| Lanzhou, CN | 35 |
| Kochi, JP | 33 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 32 |
| National Museum of Natural Sciencelocation not on record | 28 |
| Sendai, JP | 28 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 27 |
| Chengdu, CN | 26 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 23 |
| KURAlocation not on record | 23 |
| Taipei, TW | 22 |
| Xining, CN | 20 |
| JP | 20 |
| Changsha, CN | 19 |
| KR | 19 |
| Kyoto Universitylocation not on record | 18 |
| KOMlocation not on record | 18 |
| Hangzhou, CN | 17 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 17 |
| DMZ botanic gardenlocation not on record | 16 |
| Guangzhou, CN | 16 |
| Nishihara, JP | 14 |
| Strecker Museum, Baylor Universitylocation not on record | 14 |
| National Institute of Biological Resourceslocation not on record | 14 |
| Servico de Microbiologia e Imunologialocation not on record | 13 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 13 |
| Fukushima Universitylocation not on record | 13 |
| Akita Prefectural Museumlocation not on record | 13 |
| WNNUlocation not on record | 12 |
| Yunnan Universitylocation not on record | 12 |
| Obihiro Centennial City Museumlocation not on record | 12 |
| Guiyang, CN | 11 |
| Shanghai, CN | 10 |
| Sagamihara, JP | 9 |
| Nanjing, CN | 9 |
| Iwate Prefectural Museumlocation not on record | 9 |
| Xinxiang, CN | 9 |
| Taipei, TW | 8 |
| TAIElocation not on record | 8 |
| Elocation not on record | 8 |
| Shanxi Institute of Biologylocation not on record | 7 |
| Korea National Arboretumlocation not on record | 7 |
| Saint Louis, US | 7 |
| Xian, CN | 7 |
| 云南省思茅市民族传统医药研究所location not on record | 6 |
| KIRMlocation not on record | 6 |
| Dehra Dun, IN | 6 |
| Xian, CN | 6 |
| Tianjin Natural History Museumlocation not on record | 6 |
| SIHUlocation not on record | 6 |
| Otaru, JP | 6 |
| Moscow State Universitylocation not on record | 6 |
| Cambridge, US | 5 |
| Tomioka, JP | 5 |
| Kushiro City Museumlocation not on record | 5 |
| KIWElocation not on record | 5 |
| Shanghai, CN | 5 |
| Taipei, TW | 5 |
| Nishihara, JP | 5 |
| Zhejiang Museum of Natural Historylocation not on record | 4 |
| Sanda, JP | 4 |
| Xiamen, CN | 4 |
| Fujian Institute of Subtropical Botanylocation not on record | 4 |
| Awka, NG | 4 |
| Berlin, DE | 3 |
| Hebei Normal Universitylocation not on record | 3 |
| nlocation not on record | 3 |
| Central China Normal Universitylocation not on record | 3 |
| ENTClocation not on record | 3 |
| Osaka, JP | 3 |
| Wuhan, CN | 3 |
| Beijing, CN | 3 |
| Seoul, KR | 3 |
| Oskarshamn, SE | 3 |
| Claremont, US | 2 |
| Kiritappu Wetland National Trustlocation not on record | 2 |
| Angwin, US | 2 |
| Kagoshima, JP | 2 |
| FJFClocation not on record | 2 |
| Zhengzhou, CN | 2 |
| Zhejiang Universitylocation not on record | 2 |
| SCAUlocation not on record | 2 |
| Fort Worth, US | 2 |
| Edinburgh, GB | 2 |
| Hazara Universitylocation not on record | 1 |
| LDlocation not on record | 1 |
| Shenyang Agricultural Universitylocation not on record | 1 |
| Guizhou Forestry Schoollocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Guiyang, CN | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| West China Subalpine Botanical Gardenlocation not on record | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Bronx, US | 1 |
| Cambridge, US | 1 |
| CASlocation not on record | 1 |
| KNAMlocation not on record | 1 |
| Zhuzhou, CN | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Logan, US | 1 |
| Burlington, US | 1 |
| Ann Arbor, US | 1 |
| JMSlocation not on record | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| Paris, FR | 1 |
| South Kensington, GB | 1 |
| J.F.Oberlin Universitylocation not on record | 1 |
| Shenzhen, CN | 1 |
126 institutions · 2 670 of 2 696 vouchered records shown · 26 without an institution code
09Environmental DNA4 detections
Where the DNA of Artemisia japonica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found4
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 4 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.