Artemisia integrifolia

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records1 026

Data sources9

Biological traits16

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Artemisia integrifolia's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 026 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF1 026 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 36

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max1 m

Plant height min0.5 m

Life cycle & reproduction5

Dispersal typewind

Flowering endAug

Flowering startAug

Life formperennial or rhizomatous geophyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, meadows

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia integrifolia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences7

eDNA detections1

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJN861932.1 ↗216 bpRussia

ACGT

ATCGCGTCGCCCCCCACAATTCTCCGCAAGGGAACCTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAAA …

Artemisia integrifolia isolate CR136 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Artemisia integrifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records18–362n range36median36mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 367×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 10

CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1985. Chromosome numbers in some species of the family Asteraceae from the southernpart of the Soviet Far East. Bot. Zhurn. SSSR 70(7): 1000–1001. (In Russian).

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.

CCDB · ipcn-api-dl — Wang, C., F. Lu, Y. Guan & G. y. Zhang. 2001. Study on karyotypes of Artemisia sect. Artemisia Y. R. Ling in northeast China. Bull. Bot. Res., Harbin 21(2): 215–221.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.

CCDB · iapt — IAPT/IOPB Chromosome Data 23

CCDB · iapt — IAPT/IOPB Chromosome Data 26

2n 183×CCDB · iapt · CCDB · ipcn-api-dl

CCDB · iapt — IAPT/IOPB Chromosome Data 13

CCDB · ipcn-api-dl — Rostovtseva, T. S. & A. A. Nechayev. 1981. Chromosomhye chisla nekotorych vidov flory Sibiri. Sb. Novye Dannye o Fitogeografii Sibiri. 220–224.

CCDB · iapt — IAPT/IOPB Chromosome Data 17

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 026 records

Wild obs. + sensor828

Museum / vouchered198

Origin

Native1

Range

Area of Occupancy AOO2 868 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 272≤1 km 28≤10 km 48>10 km 282

630 georeferenced · 198 without coordinates

Open the mapobservation + sensor828

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 2≤1 km 3≤10 km 17>10 km 2

24 georeferenced · 174 without coordinates

Open the institutions mapphysical evidence198

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	80
Institute of Applied Ecology, Academia Sinicalocation not on record	29
Beijing, CN	14
BRNUlocation not on record	7
Servico de Microbiologia e Imunologialocation not on record	6
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	6
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	6
Jiangxi College of Educationlocation not on record	5
ENTClocation not on record	5
IWEP FEB RASlocation not on record	5
LDlocation not on record	5
Institute of the biological problems of the North FEB RASlocation not on record	4
Chengdu, CN	3
Herbarium of the Department of Botany, University of Tokyolocation not on record	3
Nanjing, CN	2
Shanghai, CN	2
Oskarshamn, SE	1
Chengdu, CN	1
Guilin, CN	1
Beijing Natural History Museumlocation not on record	1
Yangling, CN	1
Tianjin Natural History Museumlocation not on record	1
South Kensington, GB	1
Kyoto Universitylocation not on record	1
Nanjing, CN	1
Xining, CN	1
Chongqing, CN	1

27 institutions · 193 of 198 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Artemisia integrifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-2.20 °C -2.20–-2.20

Seasonal swing summer↔winter43.2 °C

Max temp (day)1.70 °C

Min temp (night)-7.00 °C

Precipitation36.6 mm/mo

Air humidity60.4 %

Moisture balance-10.1 mm/mo

Vapour deficit364 Pa

Wind speed2.10 m/s

Cloud cover58.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Artemisia integrifolia

At a glance

Sources9 archives

Size & morphology2

Life cycle & reproduction5

Diet & foraging1

Habitat & environment7

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 026 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 026 records