Artemisia gmelinii
Weber ex Stechm. · speciesAt a glance
Occurrence records3 151
Data sources12
Biological traits42
DNA specimens15
eDNA detections16
Sources12 archives
Databases and archives Artemisia gmelinii's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 151 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics15 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources42 traits
Chemical compositionLOTUS · NPASS645 compounds
Occurrence & distributionGBIF3 151 records
Environmental DNA1 datasets · 1 countries16 detections
DNA & barcodingBOLD · NCBI15 specimens
Genome at a glanceCCDB2n = 18
01Narrative
Artemisia annua, l'Armoise annuelle ou Absinthe chinoise, est une espèce de plantes dicotylédones de la famille des Asteraceae, sous-famille des Asteroideae. Ce sont des plantes herbacées annuelles, glabres. Originaire d'Eurasie et d'Afrique du Nord, l'espèce a été introduite en Europe et en Amérique. L'Armoise annuelle contient plusieurs substances actives, notamment l'artémisinine, à des teneurs qui varient fortement selon la provenance de la plante. Utilisée en médecine traditionnelle chinoise pour lutter contre les fièvres, elle est présente dans sa pharmacopée depuis plus de 2 000 ans, généralement associée avec d'autres plantes. Depuis les années 1970 on l'étudie notamment dans le traitement du paludisme. L'Armoise annuelle est proposée sous forme de tisanes, de comprimés ou de teinture comme complément alimentaire, pour le traitement de nombreuses maladies. En août 2020, l'OMS « appelle à une extrême prudence vis-à-vis de ces informations vantant l'efficacité de tels produits » dans le traitement du paludisme dans le contexte de la pandémie de COVID-19. Un article de recherche d'octobre 2023 intitulé Propriétés antivirales, virucides et antioxydantes d'Artemisia annua contre le CoV-2 du SRAS montre qu'un composant de l'armoise annuelle inhibe la réplication virale du SRAS-CoV-2[réf. nécessaire]. On extrait également de cette plante une huile essentielle aux propriétés antiseptiques, utilisée en parfumerie et cosmétique. L'armoise annuelle est plantée aussi à Java pour ses qualités ornementales.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology11
Leaf length60 mm
Leaf length max100 mm
Leaf length min20 mm
Leaf size14.11 mm²
Leaf width50 mm
Leaf width max80 mm
Leaf width min20 mm
Plant height0.5 m
Plant height max1 m
Plant height min0.5 m
Seed mass0.064 mg
Life cycle & reproduction8
Deciduousnessdeciduous
Dispersal typewind
Flowering endAug
Flowering startAug
Life formsubshrub or shrub
Life spanperennial
Lifespan years3 years
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment10
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 900 m
Elevation mean3 200 m
Elevation min1 500 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, meadows
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio21.58 g/g
Leaf c485 mg/g
Leaf dry-matter content (LDMC)355 mg/g
Leaf n24.02 mg/g
Leaf p1.6 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)17.17 mm²/mg
⚠ sources differ — TRY: 17.17 mm²/mg · GIFT: 22.15 mm²/mg
Other traits5
Leaf margindissected
Leaf spinesno
Leaf thornsno
Sla max32.69 mm²/mg
Sla min10.33 mm²/mg
03Chemical composition645 compounds
Compounds documented for Artemisia gmelinii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Eudesmane sesquiterpenoids48
Flavonols44
Cinnamic acids and derivatives36
Cadinane sesquiterpenoids31
Arteminisin31
Documented compounds645 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-(5R,7S,10S)-cis-Selina-4(15),11-dien-5-ol | present | LOTUS | |
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-3-Carene | present | LOTUS | |
| (+)-3-Thujone | present | LOTUS | |
| (+)-alpha-Carene | present | LOTUS | |
| (+)-alpha-Thujene | present | LOTUS | |
| (+)-Borneol acetate | present | LOTUS | |
| (+)-Camphene | present | LOTUS | |
| (+)-Eriodictyol | present | LOTUS | |
| (+)-Fenchone | present | LOTUS |
05DNA & barcoding15 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia gmelinii has left across the world's sequence archives.
At a glance
DNA specimens15
Marker genes4
GenBank sequences10
eDNA detections16
Countries3
The DNA barcodea real sequence read deposited for this species
TCTTTATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATT …
Artemisia gmelinii voucher KS23 HER0036 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL★ITS9★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Artemisia gmelinii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–542n range18median18mode83records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1863×CCDB · ita-fl · CCDB · slov-fl · CCDB · iapt +13
CCDB · ita-fl — TESSITORE A., CATONICA C., TAMMARO F. - 1994 (1993). Numeri cromosomici per la flora italiana: 1290-1296.. Inform. Bot. Ital. , 25(1): 47-51.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · iapt
CCDB · iber-fl — Aportacin al conocimiento citotaxonmico de ocho txones ibricos del gnero Artemisia L. (Asteraceae). Valls Xirau, J.Anales Jard. Bot. Madrid44(1): 79-96(1987).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4046
CCDB · fl-europaea — Polya, 1948
CCDB · poland — Kreitschitz A., Valles J. 2003. New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobotanica 38, 333-343.
CCDB · ipcn-api-dl — Vallés Xirau, J. 1987. Aportación al conocimiento citotaxonómico de ocho táxones Ibéricos del género Artemisia L. (Asteraceae, Anthemideae). Anales Jard. Bot. Madrid 44: 79–96.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Volkova, S. A. & E. V. Boyko. 1986. Chromosome numbers in some species of Asteraceae from the southern part of the Soviet far east. Bot. Zhurn. 71: 1693.
CCDB · ipcn-api-dl — Qiao, Y. m., X. x. Yan & S. z. Zhang. 1990. A study on the chromosomes of 20 species of the genus Artemisia. Grassl. China 1990(6): 24–31.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · ipcn-api-dl — Hu, T. m., R. Cao, H. p. Wang & S. z. Zhang. 1991. Studies on chromosomes of five species of Artemisia in Inner Mongolia. Acta Sci. Nat. Univ. Intramongol. 22(3): 422–427.
CCDB · ipcn-api-dl — Wang, C., H. q. Guan & G. y. Zhang. 1999. Study on karyotypes of sect. Abrotanum of Artemisia in northeast China. J. Wuhan Bot. Res. 17(4): 382–384.
CCDB · ipcn-api-dl — Nagl, W. & F. Ehrendorfer. 1974. DNA content, heterochromatin, mitotic index and growth in perennial and annual Anthemideae (Asteraceae). Pl. Syst. Evol. 123: 35–54.
CCDB · ipcn-api-dl — Torrell, M., M. Cerbah, S. Siljak-yakovlev & J. Vallès. 2003. Molecular cytogenetics of the genus Artemisia (Asteraceae, Anthemideae): fluorochrome banding and fluorescence in situ hybridization. I. Subgenus Seriphidium and related taxa. Pl. Syst. Evol. 239(1–2): 141–153.
CCDB · ipcn-api-dl — Kreitschitz, A. & J. Vallès. 2003. New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobot. 38(3): 333–343.
CCDB · ipcn-api-dl — Krasnikov, A. A., O. S. Zhirova, M. N. Lomonosova & S. V. Smirnov. 2003. Chromosome numbers of Asteraceae from the southern Siberia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 88(9): 151–153.
CCDB · ipcn-api-dl — Rotreklova. 2004. Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
CCDB · ipcn-api-dl — Kaul, M. K. & S. K. Bakshi. 1984. Studies on the genus Artemsia L. in north-west Himalaya with particular reference to Kashmir. Folia Geobot. Phytotax. 19: 299–316.
CCDB · ipcn-api-dl — Astanova, S. B. 1989. Khromosomnye chisla predstavitelej slozhnocvetnykh flory Tadzhikistana. Pp. 89--90 in Tesizy II Symp. Plant Karyology.
CCDB · ipcn-api-dl — Vallès, J. 2001. New or rare chromosome counts in Artemisia L. (Asteraceae, Anthemideae) and related genera from Kazakhstan. Bot. J. Linn. Soc. 137(4): 399–407.
CCDB · ipcn-api-dl — Hoshi, Y., K. Kondo, A. A. Korobkov, I. V. Tatarenko, P. V. Kulikov, V. P. Verkholat, A. Gontcharov, H. Ogura, T. Finamoto, G. Kokubugata, R. Suzuki & H. Matoba. 2004. Cytological study in the genus Artemisia L. (Asteraceae) from Russia. Chromosome Sci. 7: 83–89.
CCDB · book-ipcn72 — MASUMORI, s. 1972. On the karyotype of Artemisia annua. Bull. Fae. Educ., Yamaguchi Univ. 22(2): 35-37.
CCDB · book-ipcn67-71 — ARANO, H. 1968. The karyotypes and the geographical distribution in some groups of subfamily (Compositae) Of Japan. Kromosomo 72-73: 2371-2388.
CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol1 — Weinedel-Liebau, F. 1928 ; P6lya, L. 1949 ; Suzuka, O. 1950b, 1952 ; Arano, H. 1964b, 1968 ; Masumori, S. 1912
CCDB · book-indian_vol1 — Suzuka, O. 1956 ; Khoshoo, T.N. & Sobti, S.N. 1958
CCDB · book-indian_vol1 — Suzuka, O. 1952-1953, 1956 ; Mehra, P.N. & Remanandan, P. 1969
CCDB · eflora
CCDB · book-atlas-flowering-plants — Suzuka 1950b
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · iapt — IAPT/IOPB Chromosome Data 18
CCDB · kew — Geber G, Hasibeder G. 1980. Cytophotometric estimation of DNA contents - comparison of a new DAPI fluorescence method with Feulgen absorbance photometry. Microscopica Acta Suppl. 4: 31-35.
CCDB · kew — Garcia S, Sanz M, Garnatje T et al. 2004. Variation of DNA amount in 47 populations of the subtribe Artemisiinae and related taxa (Asteraceae, Anthemideae): karyological, ecological, and systematic implications. Genome 47: 1004-1014.
CCDB · CromoCat 2015 — Korobkov, A. A., Kotseruba, V. V., Probatova, N. S. & Gnutikov, A. A.
Nina S. Probatova2* & Aleksandr A. Gnutikov1 (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:895-897
CCDB · CromoCat 2015 — Rotreklova. (2004). Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
+16 more references
2n 5413×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +2
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt
CCDB · ipcn-api-dl — Nishikawa, T. 1986. Chromosome counts of flowering plants of Hokkaido (10). J. Hokkaido Univ. Educ., Sect. 2B 37: 5–17.
CCDB · ipcn-api-dl — Stepanov, N. V. & E. N. Muratova. 1992. Chromosome numbers in some species of higher plants of flora of the Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 77(7): 125–126.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & S. A. Sokolovskaya. 1998. Chromosome numbers in vascular plants from the islands of Peter the Great Bay and Muravyov-Amurskiy Peninsula (Primorsky territory). Bot. Žhurn. (Moscow & Leningrad) 83(5): 125–130.
CCDB · ipcn-api-dl — Probatova, N. S. 2000. Chromosome numbers in some plant species from the Razdolnaya (Suifun) river basin (Primorsky Territory). Bot. Žhurn. (Moscow & Leningrad) 85(12): 102–107.
CCDB · book-ipcn67-71 — ARANO, H. 1968. The karyotypes and the geographical distribution in some groups of subfamily (Compositae) Of Japan. Kromosomo 72-73: 2371-2388.
CCDB · book-indian_vol1 — Suzuka, O. 1950b, 1952 ; Kawatani, T. & Ohno, T. 1964
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · Cave1963 — Arano 1963d
CCDB · iapt — IAPT/IOPB Chromosome Data 19
CCDB · iapt — IAPT/IOPB Chromosome Data 23
2n 367×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +1
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & S. A. Shatalova. 2001. Chromosome numbers in some plant species from the environs of Vladivostok city (Primorsky Region). Bot. Žhurn. (Moscow & Leningrad) 86(1): 168–172.
CCDB · ipcn-api-dl — Qiao, Y. m., X. x. Yan & S. z. Zhang. 1990. A study on the chromosomes of 20 species of the genus Artemisia. Grassl. China 1990(6): 24–31.
CCDB · book-ipcn72 — KOROBKOV, A.A. 1972. On the cytotaxonomical characteristics of some species of the genus Artemisia L. in the North-East of the U.S.S.R. (in Russian) Bot. Zurn. 57: 1316-1327.
CCDB · book-indian_vol1 — Kawatani, T. & Ohno, T. 1964
CCDB · iapt — IAPT/IOPB Chromosome Data 19
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tyagi, B.R. & R. Dubey (1990). Pachytene chromosome morphology of Artemisia annua L. Cytologia 55: 43-50
n 98×CCDB · iapt · CCDB · iber-fl · CCDB · ipcn-api-dl +2
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · iber-fl — Aportacin al conocimiento citotaxonmico de ocho txones ibricos del gnero Artemisia L. (Asteraceae). Valls Xirau, J.Anales Jard. Bot. Madrid44(1): 79-96(1987).
CCDB · ipcn-api-dl — Vallés Xirau, J. 1987. Aportación al conocimiento citotaxonómico de ocho táxones Ibéricos del género Artemisia L. (Asteraceae, Anthemideae). Anales Jard. Bot. Madrid 44: 79–96.
CCDB · ipcn-api-dl — Tyagi, B. R. & R. Dubey. 1990. Pachytene chromosome morphology of Artemisia annua L. Cytologia 55: 43–50.
CCDB · book-ipcn67-71 — MEHRA, P.N., & P. REMANANDAN. 1969. In IOPB chromosome number repoI XXII. Taxon 18: 433-442.
CCDB · CromoCat 2015 — Tyagi, B.R. & R. Dubey (1990). Pachytene chromosome morphology of Artemisia annua L. Cytologia 55: 43-50
CCDB · CromoCat 2015 — Vallés Xirau, J. (1987a). Aportación al conocimiento citotaxonómico de ocho táxones ibéricos del género Artemisia L. (Asteraceae, Anthemideae). Anales Jard. Bot. Madrid 44(1): 79-96.
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Korobkov, A. A., Kotseruba, V. V., Probatova, N. S. & Gnutikov, A. A.
Nina S. Probatova2* & Aleksandr A. Gnutikov1 (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:895-897
CCDB · CromoCat 2015 — Rotreklova. (2004). Chromosome numbers for some species of vascular plants from Europe. Biologia (Bratislava) 59: 425–433.
n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 151 records
Wild obs. + sensor2 343
Museum / vouchered797
Cultivated / captive2
Other9
Origin
Introduced1
Range
Area of Occupancy AOO8 260 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 637≤1 km 121≤10 km 116>10 km 332
1 206 georeferenced · 1 137 without coordinates
Open the mapobservation + sensor2 343
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy10% within 1 km
≤1 km 24≤10 km 208>10 km 8
240 georeferenced · 557 without coordinates
Open the institutions mapphysical evidence797
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 2
2 georeferenced
Open the mapnot free-living2
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions29 of 57 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Moscow State Universitylocation not on record | 115 |
| Tsukuba, JP | 55 |
| Yangling, CN | 53 |
| Beijing, CN | 40 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 39 |
| Xining, CN | 36 |
| Lanzhou, CN | 33 |
| Urumqi, CN | 29 |
| Kyoto Universitylocation not on record | 24 |
| WNNUlocation not on record | 23 |
| Nanjing, CN | 21 |
| National Institute of Biological Resourceslocation not on record | 20 |
| Saint Louis, US | 14 |
| ENTClocation not on record | 12 |
| Kunming, CN | 12 |
| Wuhan, CN | 10 |
| Nanjing, CN | 10 |
| Cambridge, US | 9 |
| Inner Mongolia Universitylocation not on record | 9 |
| Guilin, CN | 7 |
| Shanghai, CN | 7 |
| Guangzhou, CN | 6 |
| Xian, CN | 5 |
| IWEP FEB RASlocation not on record | 5 |
| Hokkaido University Museumlocation not on record | 5 |
| Zhejiang Universitylocation not on record | 4 |
| NSMKlocation not on record | 4 |
| Taipei, TW | 4 |
| Jiangxi College of Educationlocation not on record | 3 |
| Xinxiang, CN | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Dehra Dun, IN | 2 |
| Elocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Chengdu, CN | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| Zhengzhou, CN | 2 |
| Xian, CN | 2 |
| Chongqing Museumlocation not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| WTUlocation not on record | 1 |
| Hangzhou, CN | 1 |
| Port Elizabeth Museum (Bayworld)location not on record | 1 |
| Görlitz, DE | 1 |
| University of Stellenboschlocation not on record | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Museo Athanasius Kircher di Romalocation not on record | 1 |
| Kathmandu, NP | 1 |
| Kew, GB | 1 |
| Tomioka, JP | 1 |
| Central China Normal Universitylocation not on record | 1 |
| Changsha, CN | 1 |
| SCAUlocation not on record | 1 |
| Chengdu, CN | 1 |
57 institutions · 656 of 797 vouchered records shown · 140 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Artemisia gmelinii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median-2.20 °C -2.20–-2.20
Seasonal swing summer↔winter43.2 °C
Max temp (day)1.70 °C
Min temp (night)-7.00 °C
Precipitation36.6 mm/mo
Air humidity60.4 %
Moisture balance-10.1 mm/mo
Vapour deficit364 Pa
Wind speed2.10 m/s
Cloud cover58.5 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.