Artemisia globularia

Cham. ex Besser · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records85

Data sources10

Biological traits10

DNA specimens6

eDNA detections10

Sources10 archives

Databases and archives Artemisia globularia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility85 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

giftgenome & karyotype

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF85 records

Environmental DNA1 datasets · 2 countries10 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Artemisia globularia là một loài thực vật có hoa trong họ Cúc. Loài này được Cham. ex Besser mô tả khoa học đầu tiên năm 1834.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.17 m

Plant height min0.07 m

Life cycle & reproduction3

Flowering endAug

Flowering startAug

Life spanperennial

Habitat & environment5

Climatesubalpine or subarctic

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Habitat GIFTarctic, shores, stony places

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia globularia has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences10

eDNA detections10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSJN861922.1 ↗219 bpUSA

ACGT

ATCGCGTCGCCCCCCACAATTCTCCGTAAAGGGAACTTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAA …

Artemisia globularia subsp. globularia isolate CR142 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS7★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Artemisia globularia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–362n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 183×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1975. Chromosome numbers of some Western Chukolka plant species. Bot. Žhurn. (Moscow & Leningrad) 60(3): 395–401.

CCDB · book-ipcn72 — KOROBKOV, A.A. 1972. On the cytotaxonomical characteristics of some species of the genus Artemisia L. in the North-East of the U.S.S.R. (in Russian) Bot. Zurn. 57: 1316-1327.

CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.

2n 361×CCDB · book-ipcn65

CCDB · book-ipcn65 — Zhukova 1965a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

polyploid1×GIFT · GIFT (floras)

GIFT · GIFT (floras)

08Occurrence & distribution

Record type85 records

Wild obs. + sensor40

Museum / vouchered45

Range

Area of Occupancy AOO304 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy5% within 1 km

≤100 m 1≤1 km 1≤10 km 13>10 km 23

38 georeferenced · 2 without coordinates

Open the mapobservation + sensor40

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤1 km 4≤10 km 5>10 km 6

15 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence45

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	8
University of Stellenboschlocation not on record	6
Anchorage, US	5
Whitehorse, CA	4
Wuzhou, CN	3
Stockholm, SE	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Vancouver, CA	2
Research Collection of B. A. Bennettlocation not on record	2
Provo, US	2
Chongqing Museumlocation not on record	2
Olocation not on record	1
Boise, US	1
Cambridge, US	1

14 institutions · 42 of 45 vouchered records shown · 3 without an institution code

09Environmental DNA10 detections

Where the DNA of Artemisia globularia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.50 °C 0.1–10.5

Seasonal swing summer↔winter36.1 °C

Max temp (day)10.8 °C 3.70–14.6

Min temp (night)4.70 °C -3.80–6.80

Precipitation80.4 mm/mo 40.7–140

Air humidity62.5 % 60.8–66.3

Moisture balance29.2 mm/mo

Vapour deficit400 Pa 317–484

Wind speed3.30 m/s

Cloud cover73.8 % 63.1–75.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)