Artemisia glacialis

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records4 641

Data sources8

Biological traits7

DNA specimens3

eDNA detections2

Sources8 archives

Databases and archives Artemisia glacialis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 641 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF4 641 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT4.4 Gbp

01Narrative

Artemisia glacialis, le Génépi des glaciers, est une espèce de plantes à fleurs de la famille des Asteraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology2

Plant height0.075 m

Seed mass0.322 mg

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Lifespan years4 years

Habitat & environment2

Climatesubalpine or subarctic

Growth formb H

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia glacialis has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences5

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ028908.1 ↗219 bp

ACGT

ATCGCGTCGCCCCCCACAGTTCTCCGCAAAGGGAACTTGTGTTTTGGGGGCGGATACTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAA …

Artemisia glacialis voucher Simon_BCN_11566 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS2

fungal barcode

06Genome at a glanceGoaT

The complete instruction manual Artemisia glacialis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 361 880 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Artemisia glacialis4.36 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type4 641 records

Wild obs. + sensor4 363

Museum / vouchered278

Range

Area of Occupancy AOO1 228 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy2% within 1 km

≤100 m 81≤1 km 20≤10 km 3 399>10 km 817

4 317 georeferenced · 46 without coordinates

Open the mapobservation + sensor4 363

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 2≤1 km 6≤10 km 33>10 km 10

51 georeferenced · 227 without coordinates

Open the institutions mapphysical evidence278

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zürich, CH	115
Zürich, CH	85
Bern, CH	17
LDlocation not on record	14
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	11
Oskarshamn, SE	6
Institut und Museum fuer Geologie und Palaeontologielocation not on record	6
Görlitz, DE	4
GJOlocation not on record	2
Adam Mickiewicz University in Poznańlocation not on record	2
Barcelona, ES	1
Dresden, DE	1
Sion, CH	1
Provincia di Livornolocation not on record	1
BIO-UNIPIlocation not on record	1
Bourges, FR	1
BClocation not on record	1

17 institutions · 269 of 278 vouchered records shown · 9 without an institution code

09Environmental DNA2 detections

Where the DNA of Artemisia glacialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Artemisia glacialis

At a glance

Sources8 archives

Size & morphology2

Life cycle & reproduction3

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type4 641 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type4 641 records