Artemisia frigida
Willd. · speciesAt a glance
Occurrence records15 847
Data sources12
Biological traits121
DNA specimens26
eDNA detections13
Sources12 archives
Databases and archives Artemisia frigida's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility15 847 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources121 traits
Chemical compositionLOTUS · NPASS45 compounds
Occurrence & distributionGBIF15 847 records
Environmental DNA1 datasets · 3 countries13 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB2n = 18
01Narrative
L'artemisia siberiana è una pianta perenne della famiglia delle Asteraceae. Cresce spontanea nei terreni incolti, aridi e pietrosi della Siberia e dell'America settentrionale.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology13
Leaf length11.5 mm
Leaf length max15 mm
Leaf length min8 mm
Leaf size15 mm²
Leaf width11.5 mm
Leaf width max15 mm
Leaf width min8 mm
Plant height0.375 m
⚠ sources differ — GIFT: 0.375 m · USDA: 0.61 m · TRY: 0.455 m
Plant height max0.3 m
Plant height min0.05 m
Seed mass0.076 mg
⚠ sources differ — TRY: 0.076 mg · GIFT: 0.09 mg
Seed mass max0.14 mg
Seed mass min0.05 mg
Life cycle & reproduction28
Bloom periodSummer
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typewind
Flower colourwhite
Flower conspicuousNo
Flowering endAug
Flowering startAug
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formsubshrub
Life spanperennial
Lifespan categoryShort
Lifespan years5 years
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Resprout abilityNo
Seed spread rateModerate
Seedling vigorHigh
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Fall
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatesubalpine or subarctic
Climberself-supporting
Elevation max2 600 m
Elevation mean2 300 m
Elevation min2 000 m
Epiphyteterrestrial
Foliage colorGray-Green
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourwhite
Growth formherb
⚠ sources differ — GIFT: herb · TRY: S
Growth form USDARhizomatous
Habitat GIFThills, meadows, mountains, old fields, sand, steppe, stony places
Hedge toleranceHigh
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationRounded
Small grainNo
Woodinesswoody
Physiology & chemistry26
Anaerobic toleranceLow
C:N ratioHigh
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementLow
Fire resistantNo
Fire toleranceMedium
Frost free days min90 days
Leaf C:N ratio20.72 g/g
Leaf c480 mg/g
Leaf dry-matter content (LDMC)321 mg/g
Leaf n25.46 mg/g
Leaf p2.12 mg/g
Moisture useLow
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max40 in
Precipitation min10 in
Protein potentialMedium
Salinity toleranceMedium
Shade toleranceMedium
Soil pH max9 pH
Soil pH min7 pH
Specific leaf area (SLA)15.29 mm²/mg
Temperature min-43 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound4 536 000 per lb
ToxicityNone
Veneer productNo
Other traits9
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Leaf margindissected
Leaf spinesno
Leaf thornsno
Planting density max3 000 per acre
Planting density min3 000 per acre
03Chemical composition45 compounds
Compounds documented for Artemisia frigida across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavones16
Guaiane sesquiterpenoids8
Germacrane sesquiterpenoids6
Cinnamic acids and derivatives $ Phenylethanoids4
Iridoids monoterpenoids3
Documented compounds45 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (-)-alpha-Curcumene | present | LOTUS | |
| (-)-Caryophyllene | present | LOTUS | |
| (1R,3S,5S,6R,7S,10S)-5-hydroxy-3,7,10,12-tetramethyl-2,9-dioxatetracyclo[9.3.0.01,3.06,10]tetradec-11-en-8-one | present | LOTUS | |
| (1S,2R,5S,9S,10S,11S)-2-hydroxy-2,11-dimethyl-6-methylidene-8,12,13-trioxatetracyclo[9.2.2.01,10.05,9]pentadec-14-en-7-one | present | LOTUS | |
| (1S,4aS)-7-(acetyloxymethyl)-1-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,6-tetrahydrocyclopenta[c]pyran-4-carboxylic acid | present | NPASS | |
| (2S,3S,4S,5R,6R)-6-[(2S,3R,4S,5S,6S)-6-carboxy-4,5-dihydroxy-2-[5-hydroxy-4-oxo-2-(3,4,5-trimethoxyphenyl)chromen-7-yl]oxyoxan-3-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6S)-3,4,5-trihydroxy-6-[5-hydroxy-4-oxo-2-(3,4,5-trimethoxyphenyl)chromen-7-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6S)-6-[2-(3,4-dimethoxyphenyl)-5-hydroxy-4-oxochromen-7-yl]oxy-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (3aS,6E,9S,10Z,11aR)-9-hydroxy-6,10-dimethyl-3-methylidene-3a,4,5,8,9,11a-hexahydrocyclodeca[b]furan-2-one | present | LOTUS | |
| (3aS,6R,6aR,9aR,9bS)-6-hydroxy-6,9-dimethyl-3-methylidene-4,5,6a,7,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-2-one | present | LOTUS |
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia frigida has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes6
GenBank sequences10
eDNA detections13
Countries4
The DNA barcodea real sequence read deposited for this species
GGTCACTCAGCAGACGACCGCGACACGTAAAAACAACCGAGCGTCGGTCGGATCAGGCGATCGTTTGATCCTCTCGACGCTTTGTCGATG …
Artemisia frigida isolate XB_HM836 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★trnL-F★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Artemisia frigida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records18–902n range18median18mode24records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1820×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +3
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · iapt
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Mendelak, M. & D. Schweizer. 1986. Giemsa C-banded karyotypes of some diploid Artemisia species. Pl. Syst. Evol. 152: 195–210.
CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.
CCDB · ipcn-api-dl — Qiao, Y. m., X. x. Yan & S. z. Zhang. 1990. A study on the chromosomes of 20 species of the genus Artemisia. Grassl. China 1990(6): 24–31.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · ipcn-api-dl — McArthur, E. D. & C. L. Pope. 1979. Karyotypes of four Artemisia species: A. carrathii, A. filifolia, A. frigida and A. spinescens. Great Basin Naturalist 39: 419–426.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.
CCDB · ipcn-api-dl — Keil, D. J. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 271–273.
CCDB · ipcn-api-dl — Valles, J. 2005. Chromosome numbers in the tribes Anthemideae and Inuleae (Asteraceae). Bot. J. Linn. Soc. 148: 77–85.
CCDB · book-ipcn72 — MULLIGAN, G.A . & W.J. CODY. 1972. In IOPB chromosome number reports xxxv. Taxon 21: 161-166.
CCDB · book-ipcn67-71 — KNABEN, G. 1968. Chromosome numbers of flowering plants from Central Alaska. Nytt mag. bot. 15: 240-254.
CCDB · book-ipcn73-74 — KOVANDA, M. 1972. Somatic chromosome numbers for some Asteraceae. Rhodora 74: 102-116.
CCDB · iapt — IAPT/IOPB Chromosome Data 17
CCDB · kew — Garcia S, Sanz M, Garnatje T et al. 2004. Variation of DNA amount in 47 populations of the subtribe Artemisiinae and related taxa (Asteraceae, Anthemideae): karyological, ecological, and systematic implications. Genome 47: 1004-1014.
CCDB · iapt — IAPT/IOPB Chromosome Data 26
CCDB · iapt — IAPT/IOPB Chromosome Data 32
2n 363×CCDB · ipcn-api-dl · CCDB · iapt
CCDB · ipcn-api-dl — Hu, T. m., R. Cao, H. p. Wang & S. z. Zhang. 1991. Studies on chromosomes of five species of Artemisia in Inner Mongolia. Acta Sci. Nat. Univ. Intramongol. 22(3): 422–427.
CCDB · iapt — IAPT/IOPB Chromosome Data 26
CCDB · iapt — IAPT/IOPB Chromosome Data 30
2n 901×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Wang, C., G. b. Zhou, X. f. Xing & G. y. Zhang. 1998. Study on karyotypes of Artemisia sect. Absinthum DC. in northeast China. J. Wuhan Bot. Res. 16(1): 27–31.
n 95×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Ward, D. E. 1984. Chromosome counts from New Mexico and Mexico. Phytologia 56(1): 55–60.
CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.
CCDB · ipcn-api-dl — McArthur, E. D. & C. L. Pope. 1979. Karyotypes of four Artemisia species: A. carrathii, A. filifolia, A. frigida and A. spinescens. Great Basin Naturalist 39: 419–426.
CCDB · ipcn-api-dl — McARTHUR, D. E. 1977. In IOPB chromosome number reports LV. Taxon 26: 107–109.
CCDB · ipcn-api-dl — Hartman, R. L. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type15 847 records
Wild obs. + sensor12 395
Museum / vouchered3 438
Cultivated / captive4
Other10
Origin
Native156
Introduced2
Range
Area of Occupancy AOO30 156 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy87% within 1 km
≤100 m 7 436≤1 km 1 081≤10 km 468>10 km 806
9 791 georeferenced · 2 604 without coordinates
Open the mapobservation + sensor12 395
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 127≤1 km 418≤10 km 728>10 km 166
1 439 georeferenced · 1 999 without coordinates
Open the institutions mapphysical evidence3 438
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy33% within 1 km
≤1 km 1≤10 km 2
3 georeferenced · 1 without coordinates
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions100 of 170 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 254 |
| Moscow State Universitylocation not on record | 246 |
| Bronx, US | 194 |
| Wuzhou, CN | 194 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 152 |
| Albuquerque, US | 142 |
| Chadron, US | 118 |
| University of Alberta Museumslocation not on record | 114 |
| Spearfish, US | 109 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 104 |
| Vancouver, CA | 102 |
| St. Paul, US | 98 |
| Logan, US | 92 |
| Denver, US | 91 |
| Bozeman, US | 79 |
| DOI/NPS, Greenbelt Parklocation not on record | 78 |
| Flagstaff, US | 61 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 59 |
| Missoula, US | 58 |
| WINlocation not on record | 46 |
| Yangling, CN | 43 |
| Moscow, US | 39 |
| GMBAlocation not on record | 38 |
| Lanzhou, CN | 36 |
| Provo, US | 35 |
| Xining, CN | 31 |
| Chongqing Museumlocation not on record | 30 |
| WNNUlocation not on record | 28 |
| Phoenix, US | 27 |
| Victoria, CA | 26 |
| ASUlocation not on record | 25 |
| University of Stellenboschlocation not on record | 19 |
| Saint Louis, US | 17 |
| Madison, US | 17 |
| Lincoln, US | 16 |
| BRNUlocation not on record | 16 |
| Inner Mongolia Universitylocation not on record | 16 |
| Durango, US | 15 |
| Guangzhou, CN | 15 |
| ENTClocation not on record | 15 |
| Yukon Universitylocation not on record | 15 |
| Boise, US | 15 |
| Urumqi, CN | 15 |
| Anchorage, US | 14 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 13 |
| Orem, US | 13 |
| Riverside, US | 13 |
| Rocky Mountain Biological Laboratorylocation not on record | 13 |
| Stockholm, SE | 12 |
| Kunming, CN | 12 |
| Bloomington, US | 10 |
| Jiangxi College of Educationlocation not on record | 9 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 9 |
| Pullman, US | 9 |
| Davis, US | 9 |
| Pocatello, US | 8 |
| Brookings, US | 8 |
| Tempe, US | 8 |
| Grand Junction, US | 8 |
| Pittsburg, US | 8 |
| Beijing, CN | 8 |
| Bangkok, TH | 7 |
| Weber State Universitylocation not on record | 7 |
| University of Lethbridgelocation not on record | 7 |
| WTUlocation not on record | 7 |
| Whitehorse, CA | 6 |
| Science Museum of Minnesotalocation not on record | 6 |
| Shanxi Universitylocation not on record | 6 |
| IMMUlocation not on record | 6 |
| Pomona Collegelocation not on record | 6 |
| Corvallis, US | 6 |
| Québec, CA | 6 |
| Toronto, CA | 5 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 5 |
| USFS/BHSClocation not on record | 5 |
| IMNUlocation not on record | 5 |
| Chengdu, CN | 5 |
| Philadelphia, US | 5 |
| Wlocation not on record | 4 |
| Peking Universitylocation not on record | 4 |
| Emporia, US | 4 |
| Santa Barbara, US | 4 |
| MeiseBGlocation not on record | 4 |
| Millersville, US | 4 |
| Montréal, CA | 4 |
| Nanjing, CN | 3 |
| Knoxville, US | 3 |
| Henderson, US | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| Canberra, AU | 3 |
| Durham, US | 3 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 3 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 3 |
| Ypsilanti, US | 3 |
| Bandelier National Monumentlocation not on record | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Northeastern Forestry Universitylocation not on record | 3 |
| Paris, FR | 3 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 3 |
| Caldwell, US | 3 |
| Mississippi State, US | 3 |
| Chengdu, CN | 3 |
| Tianjin Natural History Museumlocation not on record | 3 |
| USFSlocation not on record | 3 |
| Angwin, US | 3 |
| Beijing Normal Universitylocation not on record | 2 |
| New Haven, US | 2 |
| Dekalb, US | 2 |
| Acadia Universitylocation not on record | 2 |
| Shanxi Institute of Biologylocation not on record | 2 |
| Kew, GB | 2 |
| Porto Alegre, BR | 2 |
| Turku, FI | 2 |
| New Brunswick, US | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Burlington, US | 2 |
| Université Lavallocation not on record | 2 |
| Awka, NG | 2 |
| Berlin, DE | 2 |
| US | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Philadelphia, US | 2 |
| Frankfurt am Main | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Clemson, US | 2 |
| San Angelo, US | 1 |
| US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Uppsala, SE | 1 |
| ifplocation not on record | 1 |
| Claremont, US | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Mexico City, MX | 1 |
| Guilin, CN | 1 |
| Portland, US | 1 |
| Whitewater, US | 1 |
| AUAlocation not on record | 1 |
| Saint John, CA | 1 |
| Research Collection of Jonathan Farrlocation not on record | 1 |
| Hangzhou, CN | 1 |
| Green Bay, US | 1 |
| Minot State Universitylocation not on record | 1 |
| Cheney, US | 1 |
| University of Wisconsinlocation not on record | 1 |
| EL PASO, US | 1 |
| INFlocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Wuhan, CN | 1 |
| San Luis Obispo, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Austin, US | 1 |
| nlocation not on record | 1 |
| Nanjing, CN | 1 |
| TROMlocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| CASlocation not on record | 1 |
| Miami, US | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Riyadh Municipalitylocation not on record | 1 |
| Barcelona, ES | 1 |
| Guiyang, CN | 1 |
| BOISlocation not on record | 1 |
| Fargo, US | 1 |
| Auckland, NZ | 1 |
| San Diego, US | 1 |
170 institutions · 3 399 of 3 438 vouchered records shown · 38 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA13 detections
Where the DNA of Artemisia frigida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found13
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 13 detections have coordinates
Open the map3 countries0
Dry hillside with juncus balticus, anemone s…Desert hillside
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.7 °C 6.20–21.5
Seasonal swing summer↔winter33.8 °C
Max temp (day)18.4 °C 11.6–26.3
Min temp (night)8.60 °C 1.50–15.5
Precipitation54.0 mm/mo 37.4–122
Air humidity54.8 % 48.7–62.4
Moisture balance-38.6 mm/mo -113–3.30
Vapour deficit715 Pa 455–1,323
Wind speed3.70 m/s 2.70–5.00
Cloud cover42.2 % 29.1–60.8
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.