Artemisia franserioides

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records185

Data sources11

Biological traits7

DNA specimens2

eDNA detections3

Sources11 archives

Databases and archives Artemisia franserioides's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF185 records

Environmental DNA2 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Artemisia franserioides, the ragweed sagebrush or bursage mugwort, is a North American species of plants in the sunflower family. It is native to the southwestern United States (Arizona, New Mexico, Colorado, and Oklahoma) as well as northern Mexico (Chihuahua).Biota of North America Program 2014 county distribution map Artemisia franserioides is a biennial or perennial growing up to 100 cm (40 inches) tall. It is faintly aromatic, with many small, hanging flower heads. It grows in conifer forests.Flora of North America, Bursage mugwort, Artemisia franserioides Greene The specific epithet franserioides is derived from Latinized Greek, meaning resembling the genus Franseria. Franseria is now a synonym of Ambrosia (ragweeds).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Artemisia franserioides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Guaiane sesquiterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
[(3aS,4R,6R,6aS,8S,9aR,9bR)-8-hydroxy-3,9-dimethylidene-2-oxospiro[3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-6,2'-oxirane]-4-yl] acetate		present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia franserioides has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences3

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN861916.1 ↗218 bpUSA

ACGT

ATCGCGTCGCCCCCCGCAATTCTCTGTAAAGGGAACTTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAA …

Artemisia franserioides isolate CR196 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Artemisia franserioides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 91×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Keil, D. J. & D. J. Pinkava. 1976. Chromosome counts and taxonomic notes for Compositae from the United States and Mexico. Amer. J. Bot. 63: 1393–1403.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type185 records

Wild obs. + sensor23

Museum / vouchered162

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 12>10 km 1

13 georeferenced · 10 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 12≤1 km 39≤10 km 36>10 km 4

91 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence162

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Albuquerque, US	46
DOI/NPS, Colonial National Historical Parklocation not on record	28
Durango, US	14
Musee des Dinosaures d'Esperaza (Aude)location not on record	11
Denver, US	9
Riverside, US	9
ASUlocation not on record	5
Flagstaff, US	4
Logan, US	4
EL PASO, US	3
DOI/NPS, Greenbelt Parklocation not on record	3
Wuzhou, CN	2
Taipei, TW	2
Phoenix, US	2
Mexico City, MX	2
Claremont, US	2
San Angelo, US	2
Chongqing Museumlocation not on record	2
Bangkok, TH	2
Bronx, US	1
Pomona Collegelocation not on record	1
Burlington, US	1
Hermosillo, MX	1
Angwin, US	1
Bloomington, US	1
Saint Louis, US	1
San Luis Obispo, US	1
Santa Barbara, US	1

28 institutions · 161 of 162 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Artemisia franserioides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median6.00 °C 6.00–6.00

Seasonal swing summer↔winter22.2 °C

Max temp (day)9.20 °C

Min temp (night)2.40 °C

Precipitation65.9 mm/mo

Air humidity65.2 %

Moisture balance7.00 mm/mo

Vapour deficit394 Pa

Wind speed4.00 m/s

Cloud cover49.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)