Artemisia dracunculus

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records12 867

Data sources16

Biological traits50

DNA specimens40

eDNA detections15

Sources16 archives

Databases and archives Artemisia dracunculus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility12 867 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

NCBIUS National Library of Medicinesequences↗

FooDBThe Metabolomics Innovation Centrecompounds↗

foodatlascompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources50 traits

Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS5 832 compounds

Occurrence & distributionGBIF12 867 records

Environmental DNA1 datasets · 5 countries15 detections

DNA & barcodingBOLD · NCBI40 specimens

Genome at a glanceCCDB · GoaT4.9 Gbp

01Narrative

L’Estragon, Artemisia dracunculus, est une espèce de plantes herbacées vivaces à feuilles semi-persistantes, de la famille des Astéracées (Composées) que l'on rencontre dans la plupart des pays d'Eurasie et d'Amérique du Nord. Cette plante à usage condimentaire est couramment cultivée pour ses feuilles parfumées. On l'utilise également pour ses propriétés médicinales.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology13

Leaf length50 mm

Leaf length max70 mm

Leaf length min30 mm

Leaf width2.9 mm

Leaf width max6 mm

Leaf width min2 mm

Plant height0.887 m

⚠ sources differ — GIFT: 0.887 m · LEDA: 0.775 m · TRY: 0.65 m

Plant height generative0.85 m

Plant height max2 m

Plant height min0.2 m

Seed mass0.1 mg

⚠ sources differ — TRY: 0.1 mg · LEDA: 0.262 mg · GIFT: 0.183 mg

Seed mass max0.14 mg

Seed mass min0.09 mg

Life cycle & reproduction13

Deciduousnessdeciduous

Dehiscenceindehiscent

Dispersal typeself

⚠ sources differ — LEDA: boleochor · GIFT: anemochorous

Flowering endAug

Flowering startAug

Life formperennial

Life spanperennial

Lifespan years1 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Self fertilizationpresent

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment12

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max4 400 m

Elevation mean2 617 m

Elevation min800 m

Epiphyteterrestrial

Fruit typeachene

Growth formherb

Habitat GIFTarctic, forest, rivers, tundra

Mycorrhiza typearbuscular

Woodinessnon-woody

⚠ sources differ — TRY: non-woody · LEDA: non-woody · GIFT: woody

Physiology & chemistry9

Leaf C:N ratio17.07 g/g

Leaf c482 mg/g

Leaf dry-matter content (LDMC)216 mg/g

Leaf n25.71 mg/g

Leaf p3.59 mg/g

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC4

⚠ sources differ — TRY: C4 · GIFT: C3

Specific leaf area (SLA)16.59 mm²/mg

Wood density260 mg/cm³

Other traits1

Diaspore typefruit

03Chemical composition5 832 compounds

Compounds documented for Artemisia dracunculus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cookingHerbs and Spices

Compound class profile5 classes

Aminoacids79

Cinnamic acids and derivatives78

Glycerophospholipids57

Monosaccharides30

Acyclic monoterpenoids28

Documented compounds5 832 total

Compound	Amount	Source
Retinol	4,200 IU	FooDB
Potassium	3,136.95 mg/100g	FooDB
Calcium	1,186.5 mg/100g	FooDB
trans-Caffeic acid	764 mg/100g	FooDB
17alpha-ethynylestradiol	550 mg/100g	FooDB
cis-Anethole	505 mg/100g	FooDB
1-Methoxy-4-(2-propenyl)benzene	393.15 mg/100g	FooDB
Nerol	368.5 mg/100g	FooDB

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia dracunculus has left across the world's sequence archives.

At a glance

DNA specimens40

Marker genes7

GenBank sequences10

eDNA detections15

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPQ860701.1 ↗222 bpChina · 2024

ACGT

CGCATCGCGTCGCCCCCCACAACTCTCCGTAAAGGGAACTTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCC …

Artemisia dracunculus voucher ZX-3388 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

matK1rbcL7rbcLatrnL-FITS2ITS1ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Artemisia dracunculus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 916 895 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Artemisia dracunculus4.92 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× diploid · measured

Chromosome records18–902n range18median18mode49records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1826×GoaT · Kew Plant DNA C-values Database · CCDB · iapt · CCDB · fl-europaea +6

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · iapt — IAPT/IOPB Chromosome Data 10

CCDB · iapt — IAPT/IOPB Chromosome Data 9

CCDB · iapt

CCDB · fl-europaea — Rousi, 1969

CCDB · ipcn-api-dl — Krasnikova, S. A., A. A. Krasnikov, T. S. Rostovtzeva & V. M. Chanminchun. 1983. Chromosome numbers of some plant species from the south of Siberia. Bot. Zhurn. SSSR 68 (6): 827–835. (In Russian).

CCDB · ipcn-api-dl — Krasnikov, A. A. & M. N. Lomonosova. 1990. Chromosome numbers in representatives of some families of vascular plants in the flora of the Novosibirsk region. I. Bot. Žhurn. (Moscow & Leningrad) 75: 116–118.

CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.

CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.

CCDB · ipcn-api-dl — Mendelak, M. & D. Schweizer. 1986. Giemsa C-banded karyotypes of some diploid Artemisia species. Pl. Syst. Evol. 152: 195–210.

CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.

CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.

CCDB · ipcn-api-dl — Korobkov. 2003. Karyology of the genus Artemisia L. of Baical Siberia. Pages 303--305 in Botanical Study in Asiatic Russia. Vol. 1. Barnaul.

CCDB · book-ipcn75-78 — Zhukova et al. 1977a

CCDB · book-ipcn73-74 — PODLECH, D., & o. BADER. 1974. Chromosomenstudien an Afghanischen Pflanzen II. Mitt. Bot. Mtinchen 11; 457-488.

CCDB · book-indian_vol1 — Kawatani, T. & Ohno, T. 1964

CCDB · book-atlas-flowering-plants — Sp

CCDB · iapt — IAPT/IOPB Chromosome Data 17

CCDB · kew — Pellicer J, Garcia S, Garnatje T et al. 2007. Chromosome numbers in some Artemisia (Asteraceae, Anthemideae) species and genome size variation in its subgenus Dracunculus: Karyological, systematic and phylogenetic implications. Chromosome Botany 2: 45-53.

CCDB · iapt — IAPT/IOPB Chromosome Data 26

CCDB · iapt — IAPT/IOPB Chromosome Data 27

CCDB · iapt — IAPT/IOPB Chromosome Data 30

CCDB · iapt — IAPT/IOPB Chromosome Data 32

2n 3611×CCDB · iapt · CCDB · fl-europaea · CCDB · book-ipcn65 +5

CCDB · iapt

CCDB · fl-europaea — Rousi, 1969

CCDB · book-ipcn65 — Koul 1963-64c

CCDB · ipcn-api-dl — Wang, L. s. 2000. Study on karyotypes of Artemisia sect. Drancunculus Bess. in northeast China. Bull. Bot. Res., Harbin 20(4): 402–407.

CCDB · book-ipcn67-71 — ROUSI, A. 1969. Cytogenetic comparison between two kinds of cultivated tarragon (Artemisia dracunculus L.). Hereditas 62: 193-213.

CCDB · book-indian_vol1 — Khoshoo, T.N. & Sobti, S.N. 1958'; Koul, M.L.H. 1964d

CCDB · kew — Pellicer J, Garcia S, Garnatje T et al. 2007. Chromosome numbers in some Artemisia (Asteraceae, Anthemideae) species and genome size variation in its subgenus Dracunculus: Karyological, systematic and phylogenetic implications. Chromosome Botany 2: 45-53.

CCDB · Cave1958 — Khoshoo & Sobti 19S8

CCDB · iapt — IAPT/IOPB Chromosome Data 19

CCDB · iapt — IAPT/IOPB Chromosome Data 26

2n 546×CCDB · ipcn-api-dl · CCDB · kew · CCDB · iapt

CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.

CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.

CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979a. Chromosome numbers of some species of the family Asteraceae Dumort. Bot. Zhurn. SSSR 64 (4): 582–589.

CCDB · kew — Pellicer J, Garcia S, Garnatje T et al. 2007. Chromosome numbers in some Artemisia (Asteraceae, Anthemideae) species and genome size variation in its subgenus Dracunculus: Karyological, systematic and phylogenetic implications. Chromosome Botany 2: 45-53.

CCDB · iapt — IAPT/IOPB Chromosome Data 32

2n 905×CCDB · fl-europaea · CCDB · poland · CCDB · ipcn-api-dl +2

CCDB · fl-europaea — Rousi, 1969

CCDB · poland — Kreitschitz A., Valles J. 2003. New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobotanica 38, 333-343.

CCDB · ipcn-api-dl — Murín, A. 1997. Karyotaxonomy of some medicinal and aromatic plants. Thaiszia 7: 75–88.

CCDB · book-ipcn67-71 — ROUSI, A. 1969. Cytogenetic comparison between two kinds of cultivated tarragon (Artemisia dracunculus L.). Hereditas 62: 193-213.

CCDB · kew — Pellicer J, Garcia S, Garnatje T et al. 2007. Chromosome numbers in some Artemisia (Asteraceae, Anthemideae) species and genome size variation in its subgenus Dracunculus: Karyological, systematic and phylogenetic implications. Chromosome Botany 2: 45-53.

2n 721×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

n 93×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74

CCDB · ipcn-api-dl — Sundberg, S. 1983. In IOPB chromosome number reports LXXXI. Taxon 32: 665.

CCDB · ipcn-api-dl — Keil, D. J. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 271–273.

CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.

n 182×CCDB · book-ipcn65 · CCDB · Cave1958

CCDB · book-ipcn65 — Koul 1963-64c

CCDB · Cave1958 — Khoshoo & Sobti 19S8

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

07Deep time~2.69 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin2.69 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Dietphotoautotroph

08Occurrence & distribution

Record type12 867 records

Wild obs. + sensor8 779

Museum / vouchered4 042

Cultivated / captive17

Other29

Origin

Native200

Introduced54

Range

Area of Occupancy AOO35 408 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 4 818≤1 km 461≤10 km 709>10 km 687

6 675 georeferenced · 2 104 without coordinates

Open the mapobservation + sensor8 779

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 306≤1 km 572≤10 km 653>10 km 109

1 640 georeferenced · 2 402 without coordinates

Open the institutions mapphysical evidence4 042

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 15

15 georeferenced · 2 without coordinates

Open the mapnot free-living17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions116 of 207 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	276
Claremont, US	273
San Diego, US	236
Bronx, US	204
Riverside, US	179
New Brunswick, US	161
Beijing, CN	150
Wuzhou, CN	136
Albuquerque, US	98
Logan, US	80
Santa Barbara, US	79
St. Paul, US	76
Musee des Dinosaures d'Esperaza (Aude)location not on record	65
Flagstaff, US	64
Pullman, US	59
Denver, US	58
University of Alberta Museumslocation not on record	56
Chadron, US	50
Moscow, US	49
Vancouver, CA	44
ASUlocation not on record	44
Provo, US	41
SLU Artdatabankenlocation not on record	41
LDlocation not on record	40
CASlocation not on record	39
Phoenix, US	39
Yangling, CN	38
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	36
GMBAlocation not on record	36
WTUlocation not on record	35
EL PASO, US	34
Missoula, US	34
San Luis Obispo, US	33
Corvallis, US	33
Adam Mickiewicz University in Poznańlocation not on record	29
Urumqi, CN	27
Spearfish, US	25
Bozeman, US	24
Pocatello, US	22
Oskarshamn, SE	22
Davis, US	20
US	19
DOI/NPS, Greenbelt Parklocation not on record	19
BRNUlocation not on record	18
DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record	18
Madison, US	17
Saint Louis, US	17
Victoria, CA	17
Xining, CN	16
DBF-NHMDlocation not on record	16
Severin-McDaniel Insect Collectionlocation not on record	15
Boise, US	15
Kunming, CN	14
Tartu, EE	14
Canadian Department of Agriculturelocation not on record	14
Chongqing Museumlocation not on record	13
Durango, US	13
Whitehorse, CA	13
Caldwell, US	13
Austin, US	13
WINlocation not on record	13
Irvine, US	12
Angwin, US	12
Henderson, US	12
Los Angeles, US	12
MeiseBGlocation not on record	12
Bloomington, US	11
Philadelphia, US	11
Institute of Applied Ecology, Academia Sinicalocation not on record	11
Guangzhou, CN	10
Görlitz, DE	9
Karlsruhe, DE	9
Pomona Collegelocation not on record	9
Arcata, US	9
Inner Mongolia Universitylocation not on record	8
San Bernardino, US	8
Fort Worth, US	8
Oulu, FI	7
Turku, FI	7
BFLlocation not on record	6
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	6
Auckland, NZ	6
Frankfurt am Main	6
Northridge, US	6
Jiangxi College of Educationlocation not on record	6
Weber State Universitylocation not on record	5
Ensenada, MX	5
Mlocation not on record	5
Yukon Universitylocation not on record	5
Zürich, CH	4
Santa Cruz, US	4
Rocky Mountain Biological Laboratorylocation not on record	4
Zürich, CH	4
Lubbock, US	4
Eastern Nevada Landscape Coalitionlocation not on record	4
Olocation not on record	4
Anchorage, US	4
IDElocation not on record	4
Uniwersytet Opolskilocation not on record	4
Uniwersytet Śląski w Katowicachlocation not on record	4
KMNlocation not on record	3
GZUlocation not on record	3
PRClocation not on record	3
Mississippi State, US	3
La Paz, MX	3
Urumqi, CN	3
Lincoln, US	3
Uppsala, SE	3
Hermosillo, MX	3
Natural History Museum Rotterdamlocation not on record	3
INFlocation not on record	3
VALElocation not on record	3
San Jose, US	3
Research Collection of B. A. Bennettlocation not on record	3
Bern, CH	3
Pittsburg, US	3
Orem, US	3
Wlocation not on record	3
Mexico City, MX	3
University of Stellenboschlocation not on record	3
USFS/BHSClocation not on record	2
IFR-DNFlocation not on record	2
Kew, GB	2
BDBClocation not on record	2
San Angelo, US	2
Grand Junction, US	2
Mexico City, MX	2
Brookings, US	2
Porto Alegre, BR	2
ENTClocation not on record	2
Wuhan, CN	2
USP-IBlocation not on record	2
Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record	2
Provincia di Livornolocation not on record	2
ROM020location not on record	2
UNICAMPlocation not on record	2
Arizona State University Biocollectionslocation not on record	2
Allentown, US	2
Burlington, US	2
Herbarium of South China Botanical Gardenlocation not on record	2
USFSlocation not on record	2
University of Lethbridgelocation not on record	2
Minia, EG	2
National Institute for Agricultural and Veterinarian Research, Portugallocation not on record	2
Kuopio, FI	2
Bureau of Land Managementlocation not on record	2
Dekalb, US	1
Fargo, US	1
Bureau of Land Management, Caliente Field Officelocation not on record	1
Zacatecas, MX	1
San Diego Natural History Museum, Herbariumlocation not on record	1
FLASlocation not on record	1
CICYTEXlocation not on record	1
GJOlocation not on record	1
Chengdu, CN	1
UNESClocation not on record	1
Bourges, FR	1
Hebei Normal Universitylocation not on record	1
Bandelier National Monumentlocation not on record	1
Shanghai, CN	1
Yellowstone National Park Herbariumlocation not on record	1
Columbia, US	1
Tempe, US	1
Tromso University Museumlocation not on record	1
Portland, US	1
University of Guelph, OAC Herbariumlocation not on record	1
Minot State Universitylocation not on record	1
Bend, US	1
Montréal, CA	1
GB	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
cslocation not on record	1
Chapel Hill, US	1
Entomological Society of Latvialocation not on record	1
Museo Entomologico de Leonlocation not on record	1
Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record	1
DOI/NPS, Colonial National Historical Parklocation not on record	1
Porrentruy, CH	1
nbflocation not on record	1
BAYLUlocation not on record	1
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	1
Tula State Universitylocation not on record	1
Université Lavallocation not on record	1
Clemson, US	1
Christchurch, NZ	1
Paris, FR	1
Barcelona, ES	1
Uniwersytet Warszawskilocation not on record	1
Chengdu, CN	1
BClocation not on record	1
University of New Hampshirelocation not on record	1
Chicago, US	1
Dresden, DE	1
Salzburg, AT	1
AZE014location not on record	1
Stockholm, SE	1
Hazara Universitylocation not on record	1
TROMlocation not on record	1
Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Brussel, BE	1
Cincinnati, US	1
Criciúma, BR	1
Edinburgh, GB	1
UIBlocation not on record	1
Toronto, CA	1
Walla Walla, US	1

207 institutions · 3 842 of 4 042 vouchered records shown · 197 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA15 detections

Where the DNA of Artemisia dracunculus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map5 countries0

Grand CanyonNice sagebrush steppe community. No exotics …

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 6.40–22.8

Seasonal swing summer↔winter26.0 °C

Max temp (day)15.1 °C 11.2–29.5

Min temp (night)5.80 °C 2.60–15.8

Precipitation70.6 mm/mo 18.2–124

Air humidity59.8 % 42.7–62.0

Moisture balance-27.0 mm/mo

Vapour deficit548 Pa 419–1,564

Wind speed3.80 m/s

Cloud cover44.8 % 27.4–55.7

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources16 archives

Size & morphology13

Life cycle & reproduction13

Diet & foraging2

Habitat & environment12

Physiology & chemistry9

Other traits1

Compound class profile5 classes

Documented compounds5 832 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

At a glance

When this lineage existed

How it livedPBDB

Record type12 867 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions116 of 207 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Documented compounds5 832 total

Record type12 867 records