Artemisia capillaris
Thunb. · speciesAt a glance
Occurrence records3 341
Data sources11
Biological traits34
DNA specimens8
eDNA detections8
Sources11 archives
Databases and archives Artemisia capillaris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 341 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics8 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources34 traits
Chemical compositionLOTUS · NPASS612 compounds
Occurrence & distributionGBIF3 341 records
Environmental DNA1 datasets · 0 countries8 detections
DNA & barcodingBOLD · NCBI8 specimens
Genome at a glanceCCDB2n = 18
01Narrative
Artemisia capillaris — вид квіткових рослин з родини айстрових (Asteraceae). Поширення: Китай, Японія, Корея, Монголія, Пакистан, Тибет, Індія. Населяє вологі схили, пагорби, тераси, узбіччя доріг, береги річок.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology4
Leaf size419 mm²
Plant height0.5 m
⚠ sources differ — GIFT: 0.5 m · TRY: 1 m
Plant height max0.5 m
Plant height min0.3 m
Life cycle & reproduction9
Deciduousnessdeciduous
Dispersal typewind
Flowering endAug
Flowering startAug
Life formperennial or subshrub
Life spanperennial
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formtherophyte
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Growth formherb
Habitat GIFTforest, rivers, shores
Leaf formtrilobate
Mycorrhiza typenon-mycorrhizal
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · GIFT: non-woody
Physiology & chemistry8
Leaf C:N ratio17.83 g/g
Leaf c390 mg/g
Leaf dry-matter content (LDMC)367 mg/g
Leaf n23.39 mg/g
Leaf p3.89 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)24.82 mm²/mg
Other traits4
Leaf margintoothed
Leaf spinesno
Leaf thornsno
Plant support typefree-standing
03Chemical composition612 compounds
Compounds documented for Artemisia capillaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cinnamic acids and derivatives53
Menthane monoterpenoids $ Monocyclic monoterpenoids34
Flavonols34
Simple coumarins33
Pinane monoterpenoids31
Documented compounds612 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-(7S,8'R,8R)-acuminatolide | present | LOTUS | |
| (+)-(Z)-Nerolidol | present | NPASS | |
| (+)-1(10),4-Cadinadiene | present | NPASS | |
| (+)-3-Carene | present | NPASS | |
| (+)-3-Octanol | present | NPASS | |
| (+)-alpha-Carene | present | NPASS | |
| (+)-alpha-Pinene | present | NPASS | |
| (+)-alpha-Thujone | present | NPASS | |
| (+)-beta-Caryophyllene | present | NPASS | |
| (+)-Bicyclogermacrene | present | NPASS |
05DNA & barcoding8 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia capillaris has left across the world's sequence archives.
At a glance
DNA specimens8
Marker genes4
GenBank sequences10
eDNA detections8
Countries2
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCGCCCCCCACAAATTCTCCGTCAGGGGAGCTTGTGTTTCGGGGGCGGATACTGGTCTCCCGTGCTCATGGCGCGGTTGGC …
Artemisia capillaris voucher ZX-5890 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Artemisia capillaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidydiploid inferred
Chromosome records16–362n range18median18mode17records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 189×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +1
CCDB · book-ipcn65 — Arano 1965
CCDB · ipcn-api-dl — Mendelak, M. & D. Schweizer. 1986. Giemsa C-banded karyotypes of some diploid Artemisia species. Pl. Syst. Evol. 152: 195–210.
CCDB · ipcn-api-dl — Kawano, S., Y. Nagai & S. Hoshiya-Ushida. 1995. A study on the natural hybrid swarms of two Artemisia species, A. capillaris and A. japonica (Compositae) in Central Honshu, Japan, with special reference to its biological status. J. Phytogeogr. Taxon. 42: 133–153.
CCDB · ipcn-api-dl — LEE, Y. N. 1967. Chromosome numbers of flowering plants in Korea. J. Korean Res. Inst. Ewha Women's Univ. 11: 455–478.
CCDB · ipcn-api-dl — Taniguchi, K., R. Tanaka, Y. Yonezawa & H. KOMATSU. 1975. Types of banding patterns of plant chromosomes by modified BSG method. Kromosomo, II 100: 3123–3135.
CCDB · ipcn-api-dl — Kokubugata, G., K. Kondo & S. Matsumoto. 2004. Different size of total chromosome lengths in two diploid species of Artemisia (Asteraceae) in Japan. Ann. Tsukuba Bot. Gard. 23: 1–4.
CCDB · book-ipcn67-71 — ARANO, H. 1968. The karyotypes and the geographical distribution in some groups of subfamily (Compositae) Of Japan. Kromosomo 72-73: 2371-2388.
CCDB · book-ipcn67-71 — LEE, Y.N. 1967. Chromosome numbers of flowering plants in Korea (1) J. Korean Cult. Res. Inst. 11: 455-478.
CCDB · Cave1962 — Arano 1962c; Masumori 1961
2n 365×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · eflora
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1978. Chromosome numbers in Taiwan Compositae. Bot. Bull. Acad. Sin. 19: 53–66.
CCDB · ipcn-api-dl — Peng, C. i. & C. c. Hsu. 1977. In IOPB chromosome number reports LVIII. Taxon 26: 557–565.
CCDB · ipcn-api-dl — LEE, Y. N. 1967. Chromosome numbers of flowering plants in Korea. J. Korean Res. Inst. Ewha Women's Univ. 11: 455–478.
CCDB · book-ipcn67-71 — LEE, Y.N. 1967. Chromosome numbers of flowering plants in Korea (1) J. Korean Cult. Res. Inst. 11: 455-478.
CCDB · eflora
2n 163×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Qiao, Y. m., X. x. Yan & S. z. Zhang. 1990. A study on the chromosomes of 20 species of the genus Artemisia. Grassl. China 1990(6): 24–31.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
2n 271×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Kawano, S., Y. Nagai & S. Hoshiya-Ushida. 1995. A study on the natural hybrid swarms of two Artemisia species, A. capillaris and A. japonica (Compositae) in Central Honshu, Japan, with special reference to its biological status. J. Phytogeogr. Taxon. 42: 133–153.
n 82×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 341 records
Wild obs. + sensor1 843
Museum / vouchered1 435
Fossil1
Other62
Origin
Native9
Range
Area of Occupancy AOO8 060 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy81% within 1 km
≤100 m 437≤1 km 85≤10 km 61>10 km 59
642 georeferenced · 1 201 without coordinates
Open the mapobservation + sensor1 843
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy31% within 1 km
≤1 km 45≤10 km 99>10 km 1
145 georeferenced · 1 290 without coordinates
Open the institutions mapphysical evidence1 435
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions54 of 113 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 122 |
| Odawara, JP | 119 |
| Taipei, TW | 87 |
| Nagano City, JP | 76 |
| Shinshu Universitylocation not on record | 66 |
| Tokushima, JP | 59 |
| Toyama, JP | 47 |
| Kochi, JP | 43 |
| Guangzhou, CN | 40 |
| Wuhan, CN | 39 |
| Sanda, JP | 37 |
| Nishihara, JP | 36 |
| Bando, JP | 32 |
| Tomioka, JP | 31 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 31 |
| Taipei, TW | 28 |
| National Institute of Biological Resourceslocation not on record | 27 |
| DMZ botanic gardenlocation not on record | 26 |
| Nanjing, CN | 25 |
| Chengdu, CN | 24 |
| Yangling, CN | 24 |
| Taipei, TW | 21 |
| KR | 20 |
| KOMlocation not on record | 20 |
| Tsukuba, JP | 20 |
| National Marine Biodiversity Institute of Korealocation not on record | 16 |
| SIHUlocation not on record | 13 |
| KIWElocation not on record | 10 |
| Wuhan, CN | 10 |
| JP | 10 |
| Xian, CN | 10 |
| KURAlocation not on record | 10 |
| TAIElocation not on record | 9 |
| Hangzhou, CN | 9 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 9 |
| Sendai, JP | 9 |
| Akita Prefectural Museumlocation not on record | 8 |
| WNNUlocation not on record | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| Chiba, JP | 7 |
| Sagamihara, JP | 7 |
| Xiamen, CN | 6 |
| Parthenon Tama History Museumlocation not on record | 6 |
| Kunming, CN | 6 |
| Moscow State Universitylocation not on record | 5 |
| Fukushima Universitylocation not on record | 5 |
| Nishihara, JP | 5 |
| Nanjing, CN | 5 |
| Chengdu, CN | 4 |
| Peking Universitylocation not on record | 4 |
| Port Elizabeth Museum (Bayworld)location not on record | 4 |
| Kew, GB | 4 |
| Guangzhou, CN | 4 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 4 |
| Zhejiang Universitylocation not on record | 4 |
| Shanxi Universitylocation not on record | 4 |
| Xining, CN | 4 |
| Xinxiang, CN | 4 |
| Omachi Alpine Museumlocation not on record | 4 |
| Korea National Arboretumlocation not on record | 4 |
| Strecker Museum, Baylor Universitylocation not on record | 4 |
| Tianjin Natural History Museumlocation not on record | 3 |
| Berlin, DE | 3 |
| Awka, NG | 3 |
| KNAMlocation not on record | 3 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 3 |
| Saint Louis, US | 3 |
| Guilin, CN | 3 |
| Kyoto Universitylocation not on record | 3 |
| Changsha, CN | 3 |
| Chongqing Natural History Museumlocation not on record | 3 |
| FJFClocation not on record | 3 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 2 |
| Elocation not on record | 2 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| Dehra Dun, IN | 2 |
| Beijing, CN | 2 |
| Central China Normal Universitylocation not on record | 2 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 2 |
| J. Rusek Collectionlocation not on record | 2 |
| BRNUlocation not on record | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| Zhuzhou, CN | 2 |
| Jishou Universitylocation not on record | 2 |
| Hebei Normal Universitylocation not on record | 1 |
| KIRMlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Seoul, KR | 1 |
| University of Stellenboschlocation not on record | 1 |
| SXPHClocation not on record | 1 |
| LDlocation not on record | 1 |
| sxphclocation not on record | 1 |
| GNWPlocation not on record | 1 |
| Burlington, US | 1 |
| Zhengzhou, CN | 1 |
| Shanghai, CN | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| Capital Normal Universitylocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| Guiyang, CN | 1 |
| nlocation not on record | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| Cambridge, US | 1 |
| Chengdu, CN | 1 |
| SCAUlocation not on record | 1 |
| Nanchong, CN | 1 |
| Kagoshima, JP | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
113 institutions · 1 431 of 1 435 vouchered records shown · 4 without an institution code
09Environmental DNA8 detections
Where the DNA of Artemisia capillaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found8
Studies independent surveys1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 8 detections have coordinates
Open the map0 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.