Artemisia campestris
speciesAt a glance
Occurrence records82 071
Data sources13
Biological traits47
DNA specimens76
eDNA detections31
Sources13 archives
Databases and archives Artemisia campestris's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility82 071 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics76 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources47 traits
Chemical compositionLOTUS · NPASS109 compounds
Occurrence & distributionGBIF82 071 records
Environmental DNA1 datasets · 7 countries31 detections
DNA & barcodingBOLD · NCBI76 specimens
Genome at a glanceCCDB · GoaT5.2 Gbp
01Narrative
Artemisia campestris, l'Armoise des champs, ou aurone est une espèce de plantes à fleurs de la famille des Asteraceae.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass10.63 mg
Leaf size176 mm²
Plant height0.45 m
⚠ sources differ — GIFT: 0.45 m · LEDA: 0.45 m · TRY: 0.39 m
Plant height generative0.45 m
Plant height max1 m
Plant height min0.08 m
Seed length1.35 mm
Seed mass0.1 mg
⚠ sources differ — TRY: 0.1 mg · LEDA: 0.116 mg · GIFT: 0.117 mg
Seed mass max0.3 mg
Seed mass min0.084 mg
Life cycle & reproduction14
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endAug
Flowering startAug
Life formperennial or subshrub
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals < 5 years (short-lived perennials) · GIFT: perennial
Lifespan years11.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Reproduction asexualabsent
Seed number24 768
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 000 m
Elevation mean1 340 m
Elevation min500 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
⚠ sources differ — GIFT: herb · TRY: mesoxerophyte
Habitat GIFTarctic, forest, mountains, rivers, sand, stony places
Mycorrhiza typearbuscular
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · LEDA: semi-woody · GIFT: non-woody
Physiology & chemistry8
Leaf C:N ratio23.83 g/g
Leaf c445 mg/g
Leaf dry-matter content (LDMC)233 mg/g
⚠ sources differ — TRY: 233 mg/g · LEDA: 215 mg/g
Leaf n19.75 mg/g
Leaf p2.49 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)17.54 mm²/mg
Other traits1
Diaspore typefruit
03Chemical composition109 compounds
Compounds documented for Artemisia campestris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavanones14
Germacrane sesquiterpenoids7
Guaiane sesquiterpenoids7
Eudesmane sesquiterpenoids6
Flavonols6
Documented compounds109 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-4-Epi-cryptomeridiol | present | LOTUS | |
| (-)-Pinostrobin | present | LOTUS | |
| (1aS,4aS,7S,7aR,7bS)-1,1,7-trimethyl-4-methylidene-1a,2,3,4a,5,6,7a,7b-octahydrocyclopropa[h]azulen-7-ol | present | LOTUS | |
| (1S,2R,5S,8S,9S,12S,13R,14R,15R,16R,17S,19S,22S,23S,26S,27R)-12,16-dihydroxy-3,8,12,17,19,23-hexamethyl-6,18,25-trioxaoctacyclo[13.11.1.01,17.02,14.04,13.05,9.019,27.022,26]heptacos-3-ene-7,24-dione | present | LOTUS | |
| (2R)-5,6-dihydroxy-2-(4-methoxyphenyl)-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2R)-5,8-dihydroxy-2-(4-hydroxyphenyl)-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2r)-5-Hydroxy-2-(4-hydroxyphenyl)-7-methoxychroman-4-one | present | LOTUS | |
| (2R)-5-hydroxy-7-methoxy-2-phenyl-2,3-dihydrochromen-4-one | present | LOTUS | |
| (2R,3R)-2,3-Dihydro-3,5-dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-7-methoxy-4H-1-benzopyran-4-one | present | LOTUS | |
| (2S)-pinocembrin | present | LOTUS |
05DNA & barcoding76 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia campestris has left across the world's sequence archives.
At a glance
DNA specimens76
Marker genes6
GenBank sequences10
eDNA detections31
Countries9
The DNA barcodea real sequence read deposited for this species
TGTGTGCCAAGGAAAACTAAACTCAAGAAGGCTCGTTTCGTGTAGCCCCGTTCGCGGTGCGCTCATGGGACGCGGCTTCTTTATAATCAC …
Artemisia campestris voucher KS23 HER0619 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL3★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Artemisia campestris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 163 840 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Artemisia campestris5.16 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy4× tetraploid · measured
Chromosome records16–542n range36median36mode128records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3669×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iapt +13
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Murín A. & Feráková V., 1981: Karyological study of Slovakian flora III. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 28: 59-62.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Feráková V., 1986: Botanické dielo J. Ľ. Holubyho zo súčasného hľadiska, pp. 77-98. - In: Vozárová M. (ed.), Význam osobnosti Dr.h.c. Jozefa Ľudovíta Holubyho v dejinách vedy na Slovensku. Zborník zo seminára pri 150. výročí narodenia. Pezinok 27.-29. 5. 1986. Krajské osvetové stredisko, Bratislava.
CCDB · slov-fl — Feráková V., 2007: [New records in Artemisia, Chorispora, Crepis, Erucastrum, Fallopia, Helianthus, Lactuca, and Persicaria], pp. 111, 193, 214, 243, 258, 302, 354, 430. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · iber-fl — Karyological studies in some taxa of the genus Artemisia (Asteraceae). Oliva Braas, M. & J. Valls Xirau.Canad. J. Bot.72: 1126-1135(1994).
CCDB · fl-europaea — Majovsky et al.,
CCDB · poland — Pogan E., Jankun A., Ma?ecka J., Wcis?o H. et al. 1986. Further studies in chromosome numbers of Polish Angiosperms. Part XIX. Acta Biol. Cracov. Ser. Bot. 28, 65-85.
CCDB · poland — Kreitschitz A., Valles J. 2003. New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobotanica 38, 333-343.
CCDB · book-ipcn65 — Zhukova-'1965a
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun, J. Maslecka & H. Wcisslo. 1986. Further studies in chromosome numbers of Polish angiosperms. Part XIX. Acta Biol. Cracov., Ser. Bot. 28: 65–85.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Bran|9as, M. O. & J. V. Xirau. 1994. Karyological studies in some taxa of the genus Artemisia (Asteraceae). Canad. J. Bot. 72: 1126–1135.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1984. In R.E. Krogulevich & T.S. Rostovtseva, Khromosomnye Chisla Tsvetkovykh Rastenii i Sibiri Dal'nego Vostoka. Izdatel'stvo "Nauka", Sibirskoe Otdelenie, Novosibirsk. ý.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1989. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 74: 1059–1061.
CCDB · ipcn-api-dl — Murray, D. F. & S. Kelso. 1997. Chromosome numbers and notes on the taxonomy of selected Alaskan vascular plants. Rhodora 99: 33–55.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1980. Chromosome numbers and taxonomy of some species of the Anyui Mts. Bot. Zhurn. 65 (5): 651–659.
CCDB · ipcn-api-dl — Dawe, J. C. & D. F. Murray. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 265–268.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Chromosome numbers of plant species from the Tunkinsky Alpes (East Sayan). News Sib. Depart. Acad. Sci. USSR, Ser. Biol. 15(3): 46–52.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — Ouyahya, A. & J. Viano. 1988. Recherches cytogénétiques sur le genre Artemisia L. au Maroc. Bol. Soc. Brot., sér. 2 61: 105–124.
CCDB · ipcn-api-dl — Valles, J. 2005. Chromosome numbers in the tribes Anthemideae and Inuleae (Asteraceae). Bot. J. Linn. Soc. 148: 77–85.
CCDB · ipcn-api-dl — Torrell, M., J. Vallès, N. Garcia-Jacas, V. Mozaffarian & E. Gabrielian. 2001. New or rare chromosome counts in the genus Artemisia L. (Asteraceae, Anthemideae) from Armenia and Iran. Bot. J. Linn. Soc. 135(1): 51–60.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Kreitschitz, A. & J. Vallès. 2003. New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobot. 38(3): 333–343.
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn75-78 — Magulaev 1976
CCDB · book-northern-plants — Erlanclsson 1939.
CCDB · book-ipcn73-74 — FILATOVA, N.S. 1971. De caryotipis specierum Artemisii e subgenera Dracunculus (Bess.) Rydb. in arenis vigentium. Bot. Mater. Gerb. In1 Bot. ~kad. Nauk Kazahsk. SSR 7: 46-49.
CCDB · book-ipcn73-74 — MIYAGI, C. 1974. Chromosome numbers in sperrnatophytes from Okinawa Islands (II). Bilo. Mag. Okinawa 10: 17-25.
CCDB · eflora
CCDB · book-atlas-flowering-plants — Erlandsson 1939
+23 more references
2n 1841×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +7
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · ipcn-api-dl — Packer, J. G. & R. Witkus. 1982. In IOPB chromosome number reports LXXV. Taxon 31: 363–364.
CCDB · ipcn-api-dl — Vallés, J. & M. Torrell. 1995. Mediterranean chromosome number reports 5 (552--558). Fl. Medit. 5: 357–363.
CCDB · ipcn-api-dl — Xirau, J. V. & S. Siljak-yakovlev. 1997. Cytogenetic studies in the genus Artemisia L. (Asteraceae): fluorochrome-banded karyotypes of five taxa, including the Iberian endemic species Artemisia barrelieri Besser. Canad. J. Bot. 75: 595–606.
CCDB · ipcn-api-dl — Murin, A. & V. Ferakova. 1981. Caryological study of Slovakian flora III. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 28: 59–62.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · ipcn-api-dl — Volkova, S. A., E. V. Boyko & I. V. Antusheva. 2003. Chromosome numbers of some species of Kamchatka and Sakhalin flora. Bot. Žhurn. (Moscow & Leningrad) 88(9): 154–155.
CCDB · ipcn-api-dl — DJERDJOUR, B. & G. G. GUITTONNEAU. 1976. In IOPB chromosome number reports. LII. Taxon 25: 341–346.
CCDB · ipcn-api-dl — Stahevitch, A. E. & W. A. Wojtas. 1988. Chromosome numbers of some North American species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672–676.
CCDB · ipcn-api-dl — Qiao, Y. m., X. x. Yan & S. z. Zhang. 1990. A study on the chromosomes of 20 species of the genus Artemisia. Grassl. China 1990(6): 24–31.
CCDB · ipcn-api-dl — Yan, G. x., S. z. Zhang, J. f. Yan, X. q. Fu & L. y. Wang. 1989. Chromosome numbers and geographical distribution of 68 species of forage plants. Grassl. China 4: 53–60.
CCDB · book-ipcn67-71 — SOKOLOVSKAYA, A.P. 1968. A karyological investigation Of the flora of the Korjakian Land. (In Russian) Bot. Zurn. 53: 99-105.
CCDB · book-ipcn67-71 — HEDBERG, o. 1967. Chromosome numbers of vascular plants from arctic and subarctic North America. Ark. f. Bot. Ser. 2. 6: 309-326.
CCDB · book-ipcn67-71 — BHATTACHARYA, S.S., M.M. KHALIFA, & I.I. CHAUDHRI. 1971. In IOPB chromosme number reports XXXII. Taxon 20: 349-356.
CCDB · book-northern-plants — Weinedel-Liebau 1928.
CCDB · book-ipcn73-74 — KOVANDA, M. 1972. Somatic chromosome numbers for some Asteraceae. Rhodora 74: 102-116.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae- Asteraceae. Lagascalia 4: 153-211.
CCDB · book-atlas-flowering-plants — Weinedel 1928
CCDB · kew — Pellicer J, Garcia S, Garnatje T et al. 2007. Chromosome numbers in some Artemisia (Asteraceae, Anthemideae) species and genome size variation in its subgenus Dracunculus: Karyological, systematic and phylogenetic implications. Chromosome Botany 2: 45-53.
CCDB · Cave1958 — Jorgensen et al. 1958
CCDB · Cave1963 — Sokolovskaya 1963
CCDB · CromoCat 2015 — Bhattacharyya, S. S., Khalifa, M. M. & Chaudhri, I. I. (1971). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXII]. Taxon 20(2/3): 349-350.
CCDB · CromoCat 2015 — Kawatani, T. & Ohno, T. (1964). Chromosome numbers in Artemisia. Bull. Nat. Inst. Hyg. Sci. 82: 183-193.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1948). Chromosome numbers of Northern plants species. Repts. Dep. Agric. Univ. Inst. Appl. Sci. (Iceland), ser. B 3: 9-131
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Oliva Brañas, M. & J. Vallès Xirau. (1994). Karyological studies in some taxa of the genus Artemisia (Asteraceae). Canad. J. Bot. 72: 1126-1135.
CCDB · CromoCat 2015 — Ouyahya, A. & J. Viano. (1988). Recherches cytogénétiques sur le genre Artemisia L. au Maroc. Bol. Soc. Brot. 61: 105-124.
CCDB · CromoCat 2015 — Packer, J. G. & R. Witkus. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 363-364.
CCDB · CromoCat 2015 — Stahevitch, A. E. & W. A. Wotjas. (1988). Chromosome numbers of some North american species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672-676.
CCDB · CromoCat 2015 — Tischler, G. (1934). Die Bedeutungen der Polyploide für die Verbreitung der Angiospermen, erläutert an den Arten Schleswig-Holsteins, mit Ausblicken auf andere Florengebiete Bot. Jahrb. Syst. 67: 1-36
CCDB · CromoCat 2015 — Torrell, M., M. Cerbah, S. Siljak-Yakovlev & J. Vallès (2001). Étude cytogénétique de trois taxons du complexe d'Artemisia campestris L. ( Asteraceae, Anthemideae): localisation de l'hétérochromatine et de l'ADN ribosomique. Bocconea 13: 623-628.
CCDB · CromoCat 2015 — Vallés Xirau, J. & M. Torrell. (1995). Reports (552-558). Fl. Medit. 5: 357-363.
CCDB · CromoCat 2015 — Vallés Xirau, J. & S. Siljak-Yakovlev. (1997). Cytogenetic studies in the genus Artemisia L. (Asteraceae): fluorochrome-banded karyotypes of five taxa, including the Iberian endemic species Artemisia barrelieri Besser. Canad. J. Bot. 75: 595-606.
CCDB · CromoCat 2015 — Weinedel-Liebau F. (1928). Zytologische Untersuchungen an Artemisia-Arten Jahrb. Wiss. Bot. 69: 636-686
CCDB · CromoCat 2015 — Damboldt, J. (1964). x[Citada per Moore, D. M. (1982)] Madroño 17: 266-268
CCDB · CromoCat 2015 — Djerdjour, B. & Guittonneau, G. -G. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LII]. Taxon 25(2/3): 342.
CCDB · iapt — IAPT/IOPB Chromosome Data 30
+1 more references
2n 5414×CCDB · ita-fl · CCDB · iber-fl · CCDB · fl-europaea +4
CCDB · ita-fl — BRULLO S., GUGLIELMO A., PAVONE P., TERRASI M.C. - 1992 (1991). Numeri cromosomici per la flora italiana: 1251-1266.. Inform. Bot. Ital. , 23(1): 39-47.
CCDB · ita-fl — FILIGHEDDU R., URBANI M. - 1994. Artemisia variabilis Ten. (Asteraceae ) in Sardinia (Italy).. Flora Mediterranea , 4: 191-196.
CCDB · iber-fl — Nmeros cromosomticos de plantas occidentales, 1-34. Valds Bermejo, E.Anales Jard. Bot. Madrid36: 373-389(1980).
CCDB · iber-fl — Sur la caryologie de quelques plantes rcoltes pendant la III Reunion de Botanique Pninsulaire. Fernandes, A. & M. Queirs.Mem. Soc. Brot.21: 343-385(1971).
CCDB · iber-fl — Karyological studies in some taxa of the genus Artemisia (Asteraceae). Oliva Braas, M. & J. Valls Xirau.Canad. J. Bot.72: 1126-1135(1994).
CCDB · fl-europaea — Fernandes & Queiros
CCDB · ipcn-api-dl — Bran|9as, M. O. & J. V. Xirau. 1994. Karyological studies in some taxa of the genus Artemisia (Asteraceae). Canad. J. Bot. 72: 1126–1135.
CCDB · ipcn-api-dl — Valdes-Bermejo, E. 1980. Numeros cromosomaticos de plantas occidentales. 1-34. Anales Jard. Bot. Madrid 36: 373–389.
CCDB · ipcn-api-dl — Montserrat, T., M. Cerbah, S. Siljak-yakovlev & J. Vallès. 2001. Étude cytogénétique de trois taxons du complexe d'Artemisia campestris L. (Asteraceae, Anthemideae): localisation de l'hétérochromatine et de l'ADN ribosomique. Bocconea 13: 623–628.
CCDB · ipcn-api-dl — Brullo, S., A. Guglielmo, P. Pavone & M. C. Terrasi. 1991. Numeri cromosomici per la flora Italiana: 1251--1266. Inform. Bot. Ital. 23: 39–46.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1970-71. Sur la caryologie de quelque plantes recoltees pendant la Illeme reunion de botanique peninsulaire. Mem. Soc. Broteriana 21: 343-385.
CCDB · book-ipcn67-71 — FERNANDES, A., & M. QUEIROS. 1971. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. II Compositae Bol. soc. Brot. 45 (ser. 2l: 5-122.
CCDB · kew — Torrell M, Valles J. 2001. Genome size in 21 Artemisia L. species (Asteraceae, Anthemideae): Systematic, evolutionary, and ecological implications. Genome 44: 231-238.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1971a). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. II. Compositae. Bol. Soc. Brot. 45: 5-122.
2n 164×CCDB · ita-fl · CCDB · book-ipcn75-78 · CCDB · book-atlas-flowering-plants +1
CCDB · ita-fl — BERTOLANI MARCHETTI D. - 1962. Ricerche fitogeografiche e cariologiche su Artemisia lanata W.. Arch. Bot. Biogeogr. Ital. , 38-4-7(2-3): 1/7/2000.
CCDB · book-ipcn75-78 — Love & Love 1975a
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Suzuka, O. (1950a). Chromosome numbers in the genus Artemisia Jap. J. Genet. 25: 17-18
n 95×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Dalgaard, V. 1988. Chromosome numbers in some vascular plants from the Disko Bugt area (west Greenland). Willdenowia 18: 243–252.
CCDB · ipcn-api-dl — Ward, D. E. & R. W. Spellenberg. 1986. Chromosome counts of angiosperms of western North America. Phytologia 61: 119–125.
CCDB · ipcn-api-dl — Ouyahya, A. & J. Viano. 1988. Recherches cytogénétiques sur le genre Artemisia L. au Maroc. Bol. Soc. Brot., sér. 2 61: 105–124.
CCDB · CromoCat 2015 — Ouyahya, A. & J. Viano. (1988). Recherches cytogénétiques sur le genre Artemisia L. au Maroc. Bol. Soc. Brot. 61: 105-124.
CCDB · CromoCat 2015 — Ward, D.E. & R.W. Spellenberg. (1986). Chromosome counts of angiosperms of western North America Phytologia 61: 119-125
n 182×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.
CCDB · CromoCat 2015 — Laane, M. M. (1971). Chromosome numbers in Norwegian vascular plant species 6. Blyttia 29: 229-234.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type82 071 records
Wild obs. + sensor68 296
Museum / vouchered13 181
Cultivated / captive29
Other565
Origin
Native2 059
Introduced39
Range
Area of Occupancy AOO102 036 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy57% within 1 km
≤100 m 21 151≤1 km 8 752≤10 km 22 239>10 km 587
52 729 georeferenced · 15 567 without coordinates
Open the mapobservation + sensor68 296
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 660≤1 km 2 885≤10 km 6 822>10 km 270
10 637 georeferenced · 2 544 without coordinates
Open the institutions mapphysical evidence13 181
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 8>10 km 19
27 georeferenced · 2 without coordinates
Open the mapnot free-living29
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions121 of 224 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 8 115 |
| LDlocation not on record | 350 |
| Moscow State Universitylocation not on record | 338 |
| BRNUlocation not on record | 247 |
| Uniwersytet Warszawskilocation not on record | 183 |
| Olocation not on record | 177 |
| Barcelona, ES | 133 |
| Turku, FI | 120 |
| Adam Mickiewicz University in Poznańlocation not on record | 114 |
| Oskarshamn, SE | 107 |
| BDBClocation not on record | 99 |
| University of Alberta Museumslocation not on record | 98 |
| BFLlocation not on record | 85 |
| MeiseBGlocation not on record | 84 |
| Tartu, EE | 76 |
| Ann Arbor, US | 72 |
| Kuopio, FI | 70 |
| Zürich, CH | 63 |
| BIO-UNIPIlocation not on record | 59 |
| Görlitz, DE | 55 |
| Zürich, CH | 53 |
| Salzburg, AT | 52 |
| Uppsala, SE | 49 |
| SLU Artdatabankenlocation not on record | 44 |
| ASUlocation not on record | 44 |
| IFR-DNFlocation not on record | 43 |
| Trondheim, NO | 41 |
| MAlocation not on record | 41 |
| BClocation not on record | 41 |
| Denver, US | 40 |
| Berlin, DE | 38 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 38 |
| Flagstaff, US | 37 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 36 |
| València, ES | 34 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 34 |
| Logan, US | 34 |
| Tallinn, EE | 33 |
| Vancouver, CA | 32 |
| Oulu, FI | 31 |
| KMNlocation not on record | 29 |
| Lausanne, CH | 29 |
| Spearfish, US | 28 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 27 |
| Jyväskylä, FI | 26 |
| Wlocation not on record | 25 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 25 |
| Saint John, CA | 24 |
| Victoria, CA | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 21 |
| Bozeman, US | 20 |
| Helsinki, FI | 19 |
| Toronto, CA | 19 |
| TUR-Alocation not on record | 19 |
| Bergen, NO | 18 |
| Stockholm, SE | 17 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 17 |
| Provo, US | 17 |
| Albuquerque, US | 16 |
| Bronx, US | 16 |
| St. Paul, US | 16 |
| Madison, US | 15 |
| Bern, CH | 14 |
| Research Collection of B. A. Bennettlocation not on record | 13 |
| LIVlocation not on record | 13 |
| Wuzhou, CN | 13 |
| Whitehorse, CA | 12 |
| Green Bay, US | 12 |
| Tula State Universitylocation not on record | 12 |
| GJOlocation not on record | 12 |
| Provincia di Livornolocation not on record | 11 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| DBF-NHMDlocation not on record | 11 |
| SWlocation not on record | 11 |
| Chongqing Museumlocation not on record | 11 |
| UGentlocation not on record | 10 |
| Taipei, TW | 10 |
| CICYTEXlocation not on record | 10 |
| University of Stellenboschlocation not on record | 10 |
| Taipei, TW | 9 |
| EL PASO, US | 9 |
| Dresden, DE | 9 |
| Entomological Society of Latvialocation not on record | 9 |
| GZUlocation not on record | 8 |
| Beijing, CN | 8 |
| New Brunswick, US | 8 |
| Mlocation not on record | 7 |
| Porvoo, FI | 7 |
| Uniwersytet Śląski w Katowicachlocation not on record | 7 |
| WTUlocation not on record | 7 |
| University of Wisconsinlocation not on record | 7 |
| McWane Science Centerlocation not on record | 7 |
| NMBU:MINAlocation not on record | 7 |
| TROMlocation not on record | 7 |
| Salamanca, ES | 7 |
| Bloomington, US | 7 |
| PRClocation not on record | 7 |
| Phoenix, US | 6 |
| University of Lethbridgelocation not on record | 6 |
| Beijing, CN | 6 |
| WINlocation not on record | 6 |
| Karlsruhe, DE | 6 |
| Québec, CA | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 5 |
| Yukon Universitylocation not on record | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Riverside, US | 5 |
| Alicante, ES | 5 |
| Philadelphia, US | 5 |
| CJBGlocation not on record | 5 |
| Austin, US | 4 |
| Lincoln, US | 4 |
| LfUlocation not on record | 4 |
| Kunming, CN | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| BGBMlocation not on record | 4 |
| Mississippi State, US | 4 |
| Podgorica, ME | 4 |
| Fort Worth, US | 4 |
| Porrentruy, CH | 4 |
| Saint Louis, US | 4 |
| Tempe, US | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 4 |
| Minia, EG | 4 |
| South Kensington, GB | 4 |
| SZUlocation not on record | 3 |
| Bourges, FR | 3 |
| Missoula, US | 3 |
| Henderson, US | 3 |
| Göteborg, SE | 3 |
| Paris, FR | 3 |
| Science Museum of Minnesotalocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Samara National Research Universitylocation not on record | 3 |
| Nijmegen, NL | 3 |
| Université Lavallocation not on record | 3 |
| Weber State Universitylocation not on record | 3 |
| Pamplona, ES | 3 |
| USFS/BHSClocation not on record | 3 |
| Columbia, US | 3 |
| Dekalb, US | 3 |
| Salvador, BR | 2 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Moscow, US | 2 |
| Pullman, US | 2 |
| Frankfurt am Main | 2 |
| Museum of the Rockieslocation not on record | 2 |
| BSBIlocation not on record | 2 |
| BMlocation not on record | 2 |
| Pittsburg, US | 2 |
| Angwin, US | 2 |
| USFSlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Kew, GB | 2 |
| Staten Island, US | 2 |
| Jaén, ES | 2 |
| Durango, US | 2 |
| Uniwersytet Opolskilocation not on record | 2 |
| San Luis Obispo, US | 2 |
| Claremont, US | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Rovaniemi, FI | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| Fargo, US | 1 |
| Minot State Universitylocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| nbflocation not on record | 1 |
| Xiamen, CN | 1 |
| Palacký University in Olomouclocation not on record | 1 |
| Guangzhou, CN | 1 |
| Namur, BE | 1 |
| Sant Julià de Lòria, AD | 1 |
| H-AkrKGlocation not on record | 1 |
| Sion, CH | 1 |
| Fribourg, CH | 1 |
| Honolulu, US | 1 |
| Fayetteville, US | 1 |
| Sevilla, ES | 1 |
| Tromso University Museumlocation not on record | 1 |
| Whitewater, US | 1 |
| Pomona Collegelocation not on record | 1 |
| Vitoria, ES | 1 |
| KNFYlocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Emporia, US | 1 |
| Canadian Museum of Naturelocation not on record | 1 |
| TAIElocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Millersville, US | 1 |
| Bangkok, TH | 1 |
| Badajoz, ES | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| Yangling, CN | 1 |
| Austin, US | 1 |
| Granada, ES | 1 |
| Mexico City, MX | 1 |
| Madrid, ES | 1 |
| NMWlocation not on record | 1 |
| IPSlocation not on record | 1 |
| Orem, US | 1 |
| Durham, US | 1 |
| Caldwell, US | 1 |
| Nanjing, CN | 1 |
| Pocatello, US | 1 |
| Boise, US | 1 |
| Bend, US | 1 |
| Miami, US | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| New Mexico Museum of Natural History and Sciencelocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| Montréal, CA | 1 |
| Wellington, NZ | 1 |
224 institutions · 12 532 of 13 181 vouchered records shown · 424 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA31 detections
Where the DNA of Artemisia campestris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found31
Studies independent surveys1
Countries7
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 31 detections have coordinates
Open the map7 countries0
Eroding shale bank at late snowmelt site. We…Disturbed old roadbed with Elymus trachycaul…Large southeast-facing grassland slope with …Grown from seedIn railway gravel.Tidal saltmarsh with Juncus gerardii, Atripl…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.1 °C 9.70–19.6
Seasonal swing summer↔winter31.6 °C
Max temp (day)19.8 °C 15.6–24.0
Min temp (night)11.1 °C 5.10–15.2
Precipitation63.2 mm/mo 37.6–92.0
Air humidity57.6 % 53.2–63.2
Moisture balance-36.8 mm/mo -79.3–-0.5
Vapour deficit765 Pa 507–995
Wind speed2.90 m/s 1.70–4.80
Cloud cover44.2 % 36.2–49.0
CHELSA 1981–2010, ~9 km grid, at location & month of 26 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.