Artemisia annua
speciesAt a glance
Occurrence records20 136
Data sources9
Biological traits50
DNA specimens37
eDNA detections111
Sources9 archives
Databases and archives Artemisia annua's data was compiled from.
GBIFGlobal Biodiversity Information Facility20 136 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI111 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics37 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements4 literature sources50 traits
Chemical compositionNPASS542 compounds
Occurrence & distributionGBIF20 136 records
Environmental DNA6 datasets · 5 countries111 detections
DNA & barcodingBOLD · NCBI37 specimens
Genome at a glanceGoaT · NCBI≈1.8 Gbp
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology15
Leaf length50 mm
Leaf length max70 mm
Leaf length min30 mm
Leaf mass27.91 mg
Leaf size2.55 mm²
⚠ sources differ — TRY: 2.55 mm² · LEDA: 708 mm² · GIFT: 640 mm²
Leaf width40 mm
Leaf width max60 mm
Leaf width min20 mm
Plant height0.95 m
Plant height generative1 m
Plant height max1.5 m
Plant height min0.3 m
Seed mass0.03 mg
Seed mass max0.05 mg
Seed mass min0.02 mg
Life cycle & reproduction11
DeciduousnessN
⚠ sources differ — TRY: N · GIFT: deciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endSep
Flowering startAug
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 600 m
Elevation min0 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTinhabited places, roadsides, ruderal sites
Leaf formlinear
Mycorrhiza type0.00000000000234
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio21.06 g/g
Leaf c452 mg/g
Leaf dry-matter content (LDMC)215 mg/g
Leaf n21.64 mg/g
Leaf p3.02 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)34.0 mm²/mg
⚠ sources differ — TRY: 34.0 mm²/mg · LEDA: 30.01 mm²/mg · GIFT: 28.42 mm²/mg
Other traits5
Diaspore typefruit
Leaf marginentire
Leaf spinesno
Leaf thornsno
Plant support typefree-standing
03Chemical composition542 compounds
Compounds documented for Artemisia annua across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols39
Cinnamic acids and derivatives23
Flavones20
Cadinane sesquiterpenoids17
Menthane monoterpenoids $ Monocyclic monoterpenoids16
Documented compounds542 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | NPASS | |
| (+)-alpha-Pinene | present | NPASS | |
| (+)-Borneol acetate | present | NPASS | |
| (+)-Camphene | present | NPASS | |
| (+)-cis-Carveol | present | NPASS | |
| (+)-Fenchol | present | NPASS | |
| (+)-Fenchone | present | NPASS | |
| (+)-Germacrene D | present | NPASS | |
| (+)-Linalyl acetate | present | NPASS | |
| (+)-Sabinene | present | NPASS |
05DNA & barcoding37 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia annua has left across the world's sequence archives.
At a glance
DNA specimens37
Marker genes5
GenBank sequences10
eDNA detections111
Countries5
The DNA barcodea real sequence read deposited for this species
ATCGCGTCGCCCCCCACAATTCTCTGTAAAGGGAACTCGTGTTTTGGGGGCGGATAATGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAA …
Artemisia annua voucher TS-90 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL1★rbcLa★ITS9★ITS2
plant barcodefungal barcode
06Genome at a glanceGoaT · NCBI
The complete instruction manual Artemisia annua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size≈1 793 396 406 bp assembly estimate
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Artemisia annua1.79 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
Completeness96.8% BUSCO
08Occurrence & distribution
Record type20 136 records
Wild obs. + sensor17 111
Museum / vouchered2 939
Cultivated / captive4
Other82
Origin
Native1
Introduced45
Range
Area of Occupancy AOO39 708 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy58% within 1 km
≤100 m 6 768≤1 km 810≤10 km 5 104>10 km 286
12 968 georeferenced · 4 143 without coordinates
Open the mapobservation + sensor17 111
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 85≤1 km 305≤10 km 311>10 km 29
730 georeferenced · 2 209 without coordinates
Open the institutions mapphysical evidence2 939
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 4
4 georeferenced
Open the mapnot free-living4
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions142 of 259 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Paris, FR | 255 |
| Beijing, CN | 225 |
| Yangling, CN | 162 |
| Moscow State Universitylocation not on record | 88 |
| BRNUlocation not on record | 85 |
| Uniwersytet Wrocławskilocation not on record | 77 |
| Guangzhou, CN | 75 |
| Chengdu, CN | 66 |
| Kunming, CN | 64 |
| BIO-UNIPIlocation not on record | 59 |
| Philadelphia, US | 58 |
| Wuhan, CN | 47 |
| Nanjing, CN | 44 |
| Bloomington, US | 41 |
| Bronx, US | 40 |
| Guilin, CN | 40 |
| Chongqing Museumlocation not on record | 34 |
| MeiseBGlocation not on record | 34 |
| Lanzhou, CN | 33 |
| Wlocation not on record | 33 |
| BDBClocation not on record | 31 |
| Allentown, US | 31 |
| Saint Louis, US | 30 |
| Central China Normal Universitylocation not on record | 29 |
| Adam Mickiewicz University in Poznańlocation not on record | 29 |
| LDlocation not on record | 26 |
| University of Stellenboschlocation not on record | 26 |
| Wuzhou, CN | 26 |
| Xining, CN | 24 |
| Görlitz, DE | 23 |
| Chengdu, CN | 22 |
| WNNUlocation not on record | 21 |
| Urumqi, CN | 19 |
| Barcelona, ES | 18 |
| Stockholm, SE | 18 |
| Berlin, DE | 16 |
| Córdoba, AR | 16 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 15 |
| Toyama, JP | 15 |
| Xinxiang, CN | 14 |
| San Isidro, AR | 14 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 14 |
| Inner Mongolia Universitylocation not on record | 14 |
| Philadelphia, US | 13 |
| Williamsburg, US | 13 |
| Tokushima, JP | 13 |
| Odawara, JP | 12 |
| Tsukuba, JP | 12 |
| JP | 12 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 11 |
| Strecker Museum, Baylor Universitylocation not on record | 11 |
| GZUlocation not on record | 11 |
| New Haven, US | 11 |
| Bern, CH | 10 |
| NSMKlocation not on record | 10 |
| BClocation not on record | 10 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 10 |
| Burlington, US | 10 |
| National Institute of Biological Resourceslocation not on record | 9 |
| Nagano City, JP | 9 |
| Wuhan, CN | 9 |
| Vitoria, ES | 9 |
| GMBAlocation not on record | 9 |
| New Brunswick, US | 8 |
| Pullman, US | 8 |
| BFLlocation not on record | 8 |
| IMMUlocation not on record | 8 |
| Awka, NG | 8 |
| GJOlocation not on record | 8 |
| Chiba, JP | 7 |
| Guiyang, CN | 7 |
| Zhejiang Universitylocation not on record | 7 |
| Changsha, CN | 7 |
| Shanxi Institute of Biologylocation not on record | 7 |
| Madison, US | 7 |
| Shinshu Universitylocation not on record | 6 |
| Fayetteville, US | 6 |
| Kyoto Universitylocation not on record | 6 |
| Tianjin Natural History Museumlocation not on record | 6 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 6 |
| Brussel, BE | 6 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 6 |
| Xian, CN | 6 |
| Little Rock, US | 6 |
| Peking Universitylocation not on record | 5 |
| Hangzhou, CN | 5 |
| Riverside, US | 5 |
| Claremont, US | 5 |
| Provincia di Livornolocation not on record | 5 |
| Mlocation not on record | 5 |
| Millersville, US | 5 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 5 |
| Cambridge, US | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| Seoul, KR | 4 |
| Salzburg, AT | 4 |
| Kochi, JP | 4 |
| Dekalb, US | 4 |
| Shanghai, CN | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Auckland, NZ | 4 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 4 |
| Elocation not on record | 4 |
| Kew, GB | 4 |
| CJBGlocation not on record | 4 |
| Sanda, JP | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| SIHUlocation not on record | 4 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| Jackson, US | 3 |
| Minia, EG | 3 |
| Beijing, CN | 3 |
| València, ES | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Nanjing, CN | 3 |
| Columbia, US | 3 |
| Tomioka, JP | 3 |
| San Sebastián, ES | 3 |
| Chapel Hill, US | 3 |
| MAlocation not on record | 3 |
| Iwate Prefectural Museumlocation not on record | 3 |
| FJIDClocation not on record | 3 |
| Nagasaki University - Fisherieslocation not on record | 3 |
| Zhengzhou, CN | 3 |
| Santa Cruz, US | 3 |
| Chadron, US | 3 |
| Canadian Department of Agriculturelocation not on record | 3 |
| South Kensington, GB | 3 |
| Servico de Microbiologia e Imunologialocation not on record | 3 |
| Staten Island, US | 3 |
| Morgantown, US | 3 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 3 |
| Bangkok, TH | 3 |
| College Park, US | 3 |
| Sendai, JP | 3 |
| Guangzhou, CN | 3 |
| Frankfurt am Main | 2 |
| Taipei, TW | 2 |
| PRClocation not on record | 2 |
| Springfield, US | 2 |
| Oulu, FI | 2 |
| Christchurch, NZ | 2 |
| Jishou Universitylocation not on record | 2 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 2 |
| ENTClocation not on record | 2 |
| UMKClocation not on record | 2 |
| Xinjiang Institute of Ecology and Geography, Chinese Academy of Scienceslocation not on record | 2 |
| Xiamen, CN | 2 |
| Austin, US | 2 |
| SCAUlocation not on record | 2 |
| San Diego, US | 2 |
| SLU Artdatabankenlocation not on record | 2 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 2 |
| Salamanca, ES | 2 |
| Chicago, US | 2 |
| Green Bay, US | 2 |
| J. Rusek Collectionlocation not on record | 2 |
| KIRMlocation not on record | 2 |
| Ann Arbor, US | 2 |
| Taipei, TW | 2 |
| WTUlocation not on record | 2 |
| Fukushima Universitylocation not on record | 2 |
| Stockholm, SE | 2 |
| Oskarshamn, SE | 2 |
| Vancouver, CA | 2 |
| Tartu, EE | 2 |
| Zhejiang Museum of Natural Historylocation not on record | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| CJBNlocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Harrisonburg, US | 2 |
| Fujian Institute of Subtropical Botanylocation not on record | 2 |
| University of New Hampshirelocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Helsinki, FI | 2 |
| Davenport, US | 2 |
| Madrid, ES | 2 |
| Fairfax, US | 2 |
| Hobart, AU | 2 |
| Chengdu, CN | 1 |
| UFSClocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 1 |
| Zürich, CH | 1 |
| 云南省思茅市民族传统医药研究所location not on record | 1 |
| Northridge, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| Sagamihara, JP | 1 |
| Pamplona, ES | 1 |
| Guiyang, CN | 1 |
| IDElocation not on record | 1 |
| KOMlocation not on record | 1 |
| Xian, CN | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Chongqing, CN | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Korea National Arboretumlocation not on record | 1 |
| Flagstaff, US | 1 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| JBSlocation not on record | 1 |
| GAlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| JMSlocation not on record | 1 |
| KURAlocation not on record | 1 |
| Baltimore, US | 1 |
| McWane Science Centerlocation not on record | 1 |
| Osaka, JP | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| US | 1 |
| Beijing Natural History Museumlocation not on record | 1 |
| CASlocation not on record | 1 |
| Wellington, NZ | 1 |
| Jaén, ES | 1 |
| Granada, ES | 1 |
| Edmonton, CA | 1 |
| MEXUlocation not on record | 1 |
| Bando, JP | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Bourges, FR | 1 |
| EMTCMlocation not on record | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Clemson, US | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| Universidade Federal de Santa Catarinalocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Cambridge, US | 1 |
| Whitehorse, CA | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Tilburg, NL | 1 |
| Olocation not on record | 1 |
| Gujarat Biodiversity Gene Banklocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| IATMlocation not on record | 1 |
| Chicago, US | 1 |
| Knoxville, US | 1 |
| Bratislava, SK | 1 |
| Corrientes, AR | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Jefferson City, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| SVK001location not on record | 1 |
| KR | 1 |
| Turku, FI | 1 |
| CPATSAlocation not on record | 1 |
| Uppsala, SE | 1 |
| Monastir, TN | 1 |
| Taipei, TW | 1 |
| Provo, US | 1 |
| Henderson State Universitylocation not on record | 1 |
| Norfolk, US | 1 |
| Irvine, US | 1 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 1 |
| Conway, US | 1 |
| Fort Worth, US | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
259 institutions · 2 765 of 2 939 vouchered records shown · 174 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA111 detections
Where the DNA of Artemisia annua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found111
Studies independent surveys6
Countries5
Verifiable raw sequence linked18
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 111 detections have coordinates
Open the map5 countries0
PalearcticPartial plant list: Erysimum asperum?, Dodec…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature16.0 °C 10.0–24.6
pH5.10 3.80–8.70
Conductivity101 µS/cm 18.0–52,800
Salinity34.8 PSU 34.5–35.1
Organic carbon4.75 % 0.19–6.24
Water content46.9 % 4.20–73.5
Nitrate-N35.0 mg/kg 1.00–125
Nitrate0.566 µmol/L 0.346–0.786
Phosphorus18.5 mg/kg 4.00–108
Clay18.0 % 1.94–49.0
Sand35.9 % 8.81–94.3
Depth0 m 0–2.00
SoilCoastal waterMarineVertosolCalcarosolPodosolDermosolTenosolsRudosol
44 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.1 °C 2.10–16.9
Seasonal swing summer↔winter14.5 °C
Max temp (day)15.8 °C 3.20–21.3
Min temp (night)7.50 °C 0.6–14.4
Precipitation82.2 mm/mo 47.5–130
Air humidity60.9 % 56.2–65.1
Moisture balance23.3 mm/mo
Vapour deficit504 Pa 242–816
Wind speed2.60 m/s
Cloud cover30.7 % 16.9–61.4
CHELSA 1981–2010, ~9 km grid, at location & month of 84 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.