Artemisia albicans

Sòn.Garcia, Garnatje, Mc Arthur, Pellicer, S.C.Sand. & Vallès-Xirau · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Artemisia

At a glance

Occurrence records76

Data sources9

Biological traits5

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Artemisia albicans's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility76 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources5 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF76 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Sphaeromeria cana (recently proposed name Artemisia albicans) is a species of flowering plant in the family Asteraceae known by the common name gray chickensage. It is native to the western United States, where it is known from the Sierra Nevada, the adjacent desert ranges of eastern California and Nevada, and Steens Mountain of Oregon. It grows in dry, rocky mountain habitat, such as cracks and crevices, including the talus above the tree line. This is an aromatic subshrub with numerous erect branches growing up to 30 to 60 centimeters tall. It is gray-green in color and coated with woolly fibers. The leaves are linear or lance-shaped, the lower ones divided into lobes. The inflorescence is generally a cluster of flower heads lined with woolly phyllaries and containing yellow disc florets. There are no ray florets. The fruit is a ribbed achene about 2 millimeters long.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formsubshrub

Life spanperennial

Habitat & environment3

Climatetemperate

Climberself-supporting

Growth formSubshrub, Shrub, Forb/herb

03Chemical composition3 compounds

Compounds documented for Artemisia albicans across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Guaiane sesquiterpenoids3

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(3aR,4S,6R,6aR,9aR,9bR)-4,6-dihydroxy-6-methyl-3,9-dimethylidene-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one	present	LOTUS
(3aR,4S,6R,6aR,9R,9aS,9bR)-4,6-dihydroxy-6-methyl-3-methylidenespiro[3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-9,2'-oxirane]-2-one	present	LOTUS
(3R,3aR,4S,6R,6aR,9aR,9bS)-4,6-dihydroxy-3,6-dimethyl-9-methylidene-3a,4,5,6a,7,8,9a,9b-octahydro-3H-azuleno[4,5-b]furan-2-one	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia albicans has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJN861975.1 ↗219 bpUSA

ACGT

ATCGCGTCGCCCCCCGCAATTCTCCGTAAAGAGAACTTGTGTTTTGGGGGCGGATATTGGTCTCCCGTGCTCATGGCGTGGTTGGCCGAA …

Sphaeromeria cana isolate CR211 internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Artemisia albicans carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 181×CCDB · eflora

CCDB · eflora

n 91×CCDB · book-ipcn73-74

CCDB · book-ipcn73-74 — POWELL, A.M., D.W. KYHOS, & P.H. RAVEN. 1974. Chromosome numbers in Compositae. X. Amer. J. Bot. 61: 909-913.

08Occurrence & distribution

Record type76 records

Wild obs. + sensor74

Museum / vouchered2

Range

Area of Occupancy AOO196 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 51≤1 km 3≤10 km 1

55 georeferenced · 19 without coordinates

Open the mapobservation + sensor74

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the institutions mapphysical evidence2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Boise, US	1
Turku, FI	1

2 institutions · 2 of 2 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Artemisia albicans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)