Artemisia alba
Turra · speciesAt a glance
Occurrence records11 216
Data sources9
Biological traits20
DNA specimens1
eDNA detections0
Sources9 archives
Databases and archives Artemisia alba's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility11 216 records↗
BOLD SystemsCentre for Biodiversity Genomics1 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements3 literature sources20 traits
Chemical compositionLOTUS · NPASS78 compounds
Occurrence & distributionGBIF11 216 records
DNA & barcodingBOLD · NCBI1 specimens
Genome at a glanceCCDB5.9 Gbp
01Narrative
L’Armoise blanche ou Armoise camphrée, Artemisia alba, est une espèce de plantes à fleurs vivace du genre Artemisia et de la famille des Astéracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTTRY
Size & morphology7
Plant height0.21 m
Plant height generative0.311 m
Plant height max0.8 m
Plant height min0.3 m
Seed mass0.206 mg
⚠ sources differ — TRY: 0.206 mg · GIFT: 0.185 mg
Seed mass max0.28 mg
Seed mass min0.091 mg
Life cycle & reproduction6
Deciduousnesssemi-evergreen
Flowering endSep
Flowering startJul
Life formsubshrub
Life spanperennial/woody
⚠ sources differ — TRY: perennial/woody · GIFT: perennial
Raunkiær life formchamaephyte
Habitat & environment6
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formshrub
Woodinesswoody
Physiology & chemistry1
Leaf dry-matter content (LDMC)273 mg/g
03Chemical composition78 compounds
Compounds documented for Artemisia alba across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols16
Germacrane sesquiterpenoids10
Pinane monoterpenoids7
Simple coumarins6
Acyclic monoterpenoids5
Documented compounds78 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-1(10),4-Cadinadiene | present | LOTUS | |
| (+)-Ursolic Acid | present | NPASS | |
| (-)-Caryophyllene | present | LOTUS | |
| (-)-Pinocamphone | present | LOTUS | |
| (1R,2R,5S)-2,6,6-trimethylbicyclo[3.1.1]heptan-3-one | present | LOTUS | |
| (1R,2S,5R)-2,6,6-Trimethylbicyclo[3.1.1]heptan-3-one | present | LOTUS | |
| (2S,4R)-1,7,7-trimethylbicyclo(2.2.1)heptan-2-ol | present | LOTUS | |
| (3,6,10-trimethyl-2-oxo-3a,4,5,8,9,11a-hexahydro-3H-cyclodeca[b]furan-5-yl) acetate | present | LOTUS | |
| (3E,6E,8R,10S)-2,6,10-trimethyldodeca-3,6,11-triene-2,8,10-triol | present | LOTUS | |
| (3S,3aS,5S,9S,10E,11aR)-5,9-dihydroxy-3,10-dimethyl-6-methylidene-3,3a,4,5,7,8,9,11a-octahydrocyclodeca[b]furan-2-one | present | LOTUS |
05DNA & barcoding1 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia alba has left across the world's sequence archives.
At a glance
DNA specimens1
Marker genes1
GenBank sequences1
Countries1
The DNA barcodea real sequence read deposited for this species
TCGAACCCTGCAAAGCAGAACGACCCGCGGACACGTAAAAACAACCGAGTGTCGATCGGATCAAGCGCTTGTTTGATCCTCTCGACGCTT …
Artemisia alba internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★ITS1
fungal barcode
06Genome at a glanceCCDB
The complete instruction manual Artemisia alba carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 882 670 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Artemisia alba5.88 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidydiploid inferred
Chromosome records18–542n range36median36mode45records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3624×CCDB · ita-fl · CCDB · fl-europaea · CCDB · poland +6
CCDB · ita-fl — CESCA G. - 1972. Numeri cromosomici per la flora italiana: 98-107. Inform. Bot. Ital. , 4(1): 45-59.
CCDB · ita-fl — Peruzzi L. - 2012. Numeri Cromosomici per la Flora Italiana: 1490-1492. Inform. Bot. Ital. , 44(2): 388-390.
CCDB · ita-fl — RAIMONDO F.M., ROSSITTO M., OTTONELLO D. - 1984 (1983). Numeri cromosomici per la flora italiana:967-976.. Inform. Bot. Ital. , 15(1): 58-65.
CCDB · ita-fl — POSOCCO E. - 1968. Ricerche cariologiche e citotassonomiche su "Artemisia alba" Turra sensu lato.. Giorn. Bot. Ital. , 102(6): 580.
CCDB · fl-europaea — Cesca, 1972
CCDB · poland — Kreitschitz A., Valles J. 2003. New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobotanica 38, 333-343.
CCDB · mediterranean
CCDB · ipcn-api-dl — Raimondo, F. M., M. Rossitto & D. Ottonello. 1983a. Numeri cromosomici per la Flora Italiana: 983-992. Inform. Bot. Ital. 15: 180–187.
CCDB · ipcn-api-dl — Uniyal, P. L. & H. Y. Mohan/Ram. 1994. Karyomorphological studies in some members of Podostemaceae. Aquatic Bot. 47: 85–90.
CCDB · ipcn-api-dl — Xirau, J. V. & S. Siljak-yakovlev. 1997. Cytogenetic studies in the genus Artemisia L. (Asteraceae): fluorochrome-banded karyotypes of five taxa, including the Iberian endemic species Artemisia barrelieri Besser. Canad. J. Bot. 75: 595–606.
CCDB · book-ipcn72 — CESCA, G. 1972. In Numeri cromosomici per la flora Italiana. Informatore Bot. Ital. 4: 45-66.
CCDB · book-ipcn73-74 — KUZMANOV, B.A.,M.E., ANCHEV. 1973. In IOPB chromosome number reports XLI. Taxon 22: 459-464
CCDB · kew — Garcia S, Sanz M, Garnatje T et al. 2004. Variation of DNA amount in 47 populations of the subtribe Artemisiinae and related taxa (Asteraceae, Anthemideae): karyological, ecological, and systematic implications. Genome 47: 1004-1014.
CCDB · CromoCat 2015 — Kreitschitz, A. & Vallès, J. (2003). New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobot. 38(3): 333–343.
CCDB · CromoCat 2015 — Valdés Bermejo, E. (1985). Nº 11745- Artemisia alba Turra subsp. glabrescens (Willk.) Valdés-Bermejo. comb. et stat. nov. [In Notes brèves sur certaines centuries distribuées dans le fascicle 20]. Bull. Soc. Éch. Pl. Vasc. Eur. Bass. Médit. 20: 55.
CCDB · CromoCat 2015 — Peruzzi, L., D. Gargano & G. Cesca. (2005). Karyological observations on Artemisia alba Turra (Asteraceae). Caryologia 58(1): 78–82.
CCDB · CromoCat 2015 — Baksay, L. (1958). The chromosome number of Ponto-Mediterranean plant species. Ann. Hist. Nat. Mus. Natl. Hung. 9: 121-125.
CCDB · CromoCat 2015 — Kawatani, T. & Ohno, T. (1964). Chromosome numbers in Artemisia. Bull. Nat. Inst. Hyg. Sci. 82: 183-193.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, V. (1986). Chromosome numbers of Bulgarian flowering plants. I, Fam. Asteraceae. Fitologija 31: 71-74.
CCDB · CromoCat 2015 — Raimondo, F. M., M. Rossitto & D. Ottonello. (1983a). Numeri cromosomici per la flora italiana: 967-976. Inf. Bot. Ital. 15: 58-65.
CCDB · CromoCat 2015 — Vallés Xirau, J. & M. Torrell. (1995). Reports (552-558). Fl. Medit. 5: 357-363.
CCDB · CromoCat 2015 — Kuzmanov, B. A. & Ancev, M. E. (1973). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLI]. Taxon 22(4): 461.
2n 1815×CCDB · ita-fl · CCDB · fl-europaea · CCDB · poland +5
CCDB · ita-fl — PERUZZI L., GARGANO D., CESCA G. - 2005. Karyological observations on Artemisia alba Turra (Asteraceae). Caryologia , 58(1): 78-82.
CCDB · fl-europaea — Skalinska et al.,
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · poland — Kreitschitz A., Valles J. 2003. New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobotanica 38, 333-343.
CCDB · ipcn-api-dl — Johnson, M. A. T. & P. E. Brandham. 1997. New chromosome numbers in petaloid monocotyledons and in other miscellaneous angiosperms. Kew Bull. 52(1): 121–138.
CCDB · eflora
CCDB · kew — Garcia S, Sanz M, Garnatje T et al. 2004. Variation of DNA amount in 47 populations of the subtribe Artemisiinae and related taxa (Asteraceae, Anthemideae): karyological, ecological, and systematic implications. Genome 47: 1004-1014.
CCDB · CromoCat 2015 — Kreitschitz, A. & Vallès, J. (2003). New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobot. 38(3): 333–343.
CCDB · CromoCat 2015 — Kawatani, T. & Ohno, T. (1964). Chromosome numbers in Artemisia. Bull. Nat. Inst. Hyg. Sci. 82: 183-193.
CCDB · CromoCat 2015 — Skalinska, M., R., Czapik R. & M. Piotrowicz. (1959). Further studies in chromosome numbers of Polish angiosperms (Dicotyledons). Acta Soc. Bot. Poloniae 28(3): 487-529
CCDB · CromoCat 2015 — Peruzzi, L., D. Gargano & G. Cesca. (2005). Karyological observations on Artemisia alba Turra (Asteraceae). Caryologia 58(1): 78–82.
CCDB · CromoCat 2015 — Quézel, P. (1957). Peuplement végétal des hautes montagnes de l'Afrique du Nord. Encycl. Biogéogr. Ecol. 10(137): 1-463.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
CCDB · iapt — IAPT/IOPB Chromosome Data 32
2n 544×CCDB · ita-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ita-fl — CAPINERI R., D'AMATO G., MARCHI P. - 1979 (1978). Numeri cromosomici per la flora italiana:534-583.. Inform. Bot. Ital. , 10(3): 421-465.
CCDB · ipcn-api-dl — Capineri, R., G. D'Amato & P. Marchi. 1978. Numeri cromosomici per la Flora Italiana. 534-583. Inform. Bot. Ital. 10: 421-465.
CCDB · CromoCat 2015 — Peruzzi, L., D. Gargano & G. Cesca. (2005). Karyological observations on Artemisia alba Turra (Asteraceae). Caryologia 58(1): 78–82.
CCDB · CromoCat 2015 — Capineri, R., D'Amato, G. & Marchi, P. (1978b). Numeri cromosomici per la flora italiana: 534-583. Inf. Bot. Ital. 10: 421-465.
2n 202×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · CromoCat 2015 — Mathew, A. & Mathew, P. M. (1988). Cytological studies on the south Indian Compositae Glimpses Pl. Res. 8: 1-177.
n 97×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Ouyahya, A. & J. Viano. 1988. Recherches cytogénétiques sur le genre Artemisia L. au Maroc. Bol. Soc. Brot., sér. 2 61: 105–124.
CCDB · ipcn-api-dl — Duyahya, J. V. 1981. Caryologie de taxons endemiques marrocans du genere Artemisia L. Bol. Soc. Brot. 53: 907–919.
CCDB · ipcn-api-dl — Stahevitch, A. E. & W. A. Wojtas. 1988. Chromosome numbers of some North American species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672–676.
CCDB · CromoCat 2015 — Stahevitch, A. E. & W. A. Wotjas. (1988). Chromosome numbers of some North american species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672-676.
CCDB · CromoCat 2015 — Ouyahya, A. & J. Viano. (1981). Caryologie de taxons endémiques marocains du genre Artemisia L. Bol. Soc. Brot. 53: 907-919.
CCDB · CromoCat 2015 — Ouyahya, A. & J. Viano. (1988). Recherches cytogénétiques sur le genre Artemisia L. au Maroc. Bol. Soc. Brot. 61: 105-124.
CCDB · CromoCat 2015 — Duyahya, J.V. (1981). Caryologie de taxons endemiques marrocans du genere Artemisia L. Bol. Soc. Brot. 53: 907-919
n 05×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Kreitschitz, A. & Vallès, J. (2003). New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobot. 38(3): 333–343.
CCDB · CromoCat 2015 — Peruzzi, L., D. Gargano & G. Cesca. (2005). Karyological observations on Artemisia alba Turra (Asteraceae). Caryologia 58(1): 78–82.
n 102×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · CromoCat 2015 — Mathew, A. & Mathew, P. M. (1988). Cytological studies on the south Indian Compositae Glimpses Pl. Res. 8: 1-177.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type11 216 records
Wild obs. + sensor10 491
Museum / vouchered696
Cultivated / captive1
Other28
Origin
Native146
Introduced1
Range
Area of Occupancy AOO10 240 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy26% within 1 km
≤100 m 1 510≤1 km 649≤10 km 6 147>10 km 65
8 371 georeferenced · 2 120 without coordinates
Open the mapobservation + sensor10 491
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy62% within 1 km
≤100 m 19≤1 km 149≤10 km 102>10 km 2
272 georeferenced · 424 without coordinates
Open the institutions mapphysical evidence696
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1
1 georeferenced
Open the mapnot free-living1
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions25 of 53 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 244 |
| MeiseBGlocation not on record | 76 |
| València, ES | 47 |
| Barcelona, ES | 42 |
| Vitoria, ES | 30 |
| BDBClocation not on record | 22 |
| MAlocation not on record | 19 |
| BClocation not on record | 18 |
| Berlin, DE | 17 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 17 |
| San Sebastián, ES | 9 |
| Museo Achille Folettolocation not on record | 8 |
| GZUlocation not on record | 8 |
| Salamanca, ES | 8 |
| BRNUlocation not on record | 7 |
| Görlitz, DE | 7 |
| LDlocation not on record | 7 |
| PRClocation not on record | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| Jaén, ES | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 5 |
| Bourges, FR | 5 |
| Granada, ES | 5 |
| Wlocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 4 |
| Maringá, BR | 3 |
| Madrid, ES | 3 |
| CICYTEXlocation not on record | 3 |
| GJOlocation not on record | 3 |
| Dresden, DE | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Cascavel, BR | 2 |
| UFOPlocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Oskarshamn, SE | 2 |
| Porto Alegre, BR | 2 |
| Bloomington, US | 2 |
| OLAlocation not on record | 1 |
| Porrentruy, CH | 1 |
| PUC-RSlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Alicante, ES | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Sevilla, ES | 1 |
| STUlocation not on record | 1 |
| Namur, BE | 1 |
| Badajoz, ES | 1 |
| Paris, FR | 1 |
| UTFPR-DVlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Pamplona, ES | 1 |
| Córdoba, AR | 1 |
53 institutions · 673 of 696 vouchered records shown · 23 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.