Artemisia absinthium
speciesAt a glance
Occurrence records92 005
Data sources16
Biological traits55
DNA specimens34
eDNA detections22
Sources16 archives
Databases and archives Artemisia absinthium's data was compiled from.
WikipediaWikimedia Foundation17 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility92 005 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics34 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources55 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS289 compounds
Occurrence & distributionGBIF92 005 records
Environmental DNA1 datasets · 8 countries22 detections
DNA & barcodingBOLD · NCBI34 specimens
Genome at a glanceCCDB · GoaT4.4 Gbp
01Narrative
Artemisia absinthium (wormwood, grand wormwood, absinthe, absinthium, absinthe wormwood, mugwort, wermout, wermud, wormit, wormod) is a species of Artemisia, native to temperate regions of Eurasia and North Africa, and widely naturalized in Canada and the northern United States. It is grown as an ornamental plant and is used as an ingredient in the spirit absinthe and some other alcoholic beverages.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology19
Fruit length1.05 mm
Leaf length155 mm
⚠ sources differ — AusTraits: 155 mm · GIFT: 100 mm
Leaf length max300 mm
Leaf length min2 mm
Leaf mass99.43 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 2 476 mm² · GIFT: 2 476 mm²
Leaf width200 mm
⚠ sources differ — AusTraits: 200 mm · GIFT: 80 mm
Leaf width max90 mm
Leaf width min2 mm
Plant height0.713 m
⚠ sources differ — GIFT: 0.713 m · AusTraits: 0.9 m · LEDA: 0.825 m · TRY: 0.867 m
Plant height generative0.6 m
Plant height max1.7 m
Plant height min0.4 m
Seed length1.17 mm
Seed length max1.2 mm
Seed length min1.2 mm
Seed mass0.105 mg
⚠ sources differ — TRY: 0.105 mg · LEDA: 0.104 mg · GIFT: 0.111 mg
Seed mass max0.2 mg
Seed mass min0.08 mg
Life cycle & reproduction15
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: unspecialized
Flowering endAug
Flowering startJul
Life formperennial
Life spanperennial
Lifespan years4 years
Pollination modeabiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Reproduction asexualabsent
Seed number4 500
Self fertilizationpresent
Sex typemonoecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 700 m
Elevation mean1 300 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTdesert, hills, mountains, rivers
Mycorrhiza typearbuscular
Woodinessvariable
⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous · LEDA: semi-woody · GIFT: non-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)220 mg/g
Leaf n22.1 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)41.49 mm²/mg
⚠ sources differ — TRY: 41.49 mm²/mg · LEDA: 26.7 mm²/mg · GIFT: 30.36 mm²/mg
Other traits2
Diaspore typegenerative dispersule
Plant support typefree-standing
03Chemical composition289 compounds
Compounds documented for Artemisia absinthium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking💊 Medicinal use documented
Compound class profile5 classes
Guaiane sesquiterpenoids36
Furofuranoid lignans19
Flavonols12
Germacrane sesquiterpenoids12
Acyclic monoterpenoids10
Documented compounds289 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| FAT | 381,000 ppm | DukesPhytochem | |
| PROTEIN | 334,000 ppm | DukesPhytochem | |
| TANNIN | 77,000 ppm | DukesPhytochem | |
| ASH | 66,000 ppm | DukesPhytochem | |
| EO | 17,000 ppm | DukesPhytochem | |
| TRANS-EPOXYOCIMENE | 5,700 ppm | DukesPhytochem | |
| CIS-EPOXYOCIMENE | 5,700 ppm | DukesPhytochem | |
| ASCORBIC-ACID | 2,600 ppm | DukesPhytochem | |
| ALPHA-THUJONE | 1,750 ppm | DukesPhytochem | |
| BETA-THUJONE | 1,750 ppm | DukesPhytochem |
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artemisia absinthium has left across the world's sequence archives.
At a glance
DNA specimens34
Marker genes7
GenBank sequences10
eDNA detections22
Countries9
The DNA barcodea real sequence read deposited for this species
TTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCACAGTTCTCCGCAAAGGGAACTTGTG …
Artemisia absinthium isolate 2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK3★rbcL3★rbcLa★ITS4★ITS1★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Artemisia absinthium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 376 550 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Artemisia absinthium4.38 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–362n range18median18mode83records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1881×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +16
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Hindáková M. & Činčura F., 1968: Angaben über die Zahl und Morphologie der Chromosomen einiger Pflanzenarten aus dem Territorium der Ostslowakei I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 14 [1967]: 181-227.
CCDB · slov-fl — Váchová M. & Feráková V., 1986: Karyological study of the Slovak flora XII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 57-62.
CCDB · slov-fl — Murín A., 1997: Karyotaxonomy of some medicinal and aromatic plants. - Thaiszia - J. Bot., Košice 7: 75-88.
CCDB · iapt — IAPT/IOPB Chromosome Data 14
CCDB · brit-fl — Morton, J.K. Watsonia 11: 211-223 (1977)
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4041
CCDB · fl-europaea — Polya, 1950
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · poland — ?ukowski W. and S?owi?ska T. 1979. Chromosome numbers of Angiosperms of North-Western Poland. Part 1. Fragm. Flor. Geobot. 25, 477-483.
CCDB · poland — Kreitschitz A., Valles J. 2003. New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobotanica 38, 333-343.
CCDB · book-ipcn65 — Koul 1963-64c
CCDB · ipcn-api-dl — Ouyahya, A. & J. Viano. 1988. Recherches cytogénétiques sur le genre Artemisia L. au Maroc. Bol. Soc. Brot., sér. 2 61: 105–124.
CCDB · ipcn-api-dl — Mendelak, M. & D. Schweizer. 1986. Giemsa C-banded karyotypes of some diploid Artemisia species. Pl. Syst. Evol. 152: 195–210.
CCDB · ipcn-api-dl — Kuzmanov, B. A., S. B. Georgieva & V. A. Nikolova. 1986. Chromosome numbers of Bulgarian flowering plants. I. Fam. Asteraceae. Fitologija 31: 71–74.
CCDB · ipcn-api-dl — Kaul, M. K. & S. K. Bakshi. 1984. Studies on the genus Artemsia L. in north-west Himalaya with particular reference to Kashmir. Folia Geobot. Phytotax. 19: 299–316.
CCDB · ipcn-api-dl — Afzal-Raf;auu, Z., J. Vianot, M. Ramade & M. P. Bourreil. 1985. Analyses des charactères caryologiques et écologiques de quelques taxons dans les massifs du Lubéron, de Lure et du Mont-Ventoux. Rev. Cytol. Biol. Veg. Bot. 8: 33–62.
CCDB · ipcn-api-dl — Semerenko, L. V. 1989. Chromosome numbers in some members of the families Asteraceae, Fabaceae, Orchidaceae and Poaceae from the Berezinsky Biosphere Reservation (Byelorussia) flora. Bot. Žhurn. (Moscow & Leningrad) 74: 1671–1673.
CCDB · ipcn-api-dl — Verlaque, R., M. Seidenbinder & P. Donadille. 1987. Recherches cytotaxonomiques sur la spéciation en région Méditerranéenne I: espèces a nombre chromosomique stable. Biol.-Ecol. Medit. 10: 273–289.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1991. Chromosome numbers in some plant species from the south-west of the Komi ASSR. Bot. Žhurn. (Moscow & Leningrad) 76: 769–771.
CCDB · ipcn-api-dl — Magulaev, A. Y. 1992. Chromosome numbers in some species of vascular plants of the northern Caucasus flora. Bot. Žhurn. (Moscow & Leningrad) 77(10): 88–90.
CCDB · ipcn-api-dl — Dabrowska, J. 1992. Chromosome number and DNA content in taxa of Achillea L. in relation to the distribution of the genus. Prace Bot. Univ. Wroclawsk. 49: 1–83.
CCDB · ipcn-api-dl — Váchová, M. & V. Feráková. 1986. Karyological study of the Slovak flora XII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 57–62.
CCDB · ipcn-api-dl — Dempsey, R. E., R. J. Gornall & J. P. Bailey. 1994. Contributions to a cytological catalogue of the British and Irish flora, 4. Watsonia 20: 63–66.
CCDB · ipcn-api-dl — Murín, A. 1997. Karyotaxonomy of some medicinal and aromatic plants. Thaiszia 7: 75–88.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Morton, J. K. 1981. Chromosome numbers in Compositae from Canada and the U.S.A. Bot. J. Linn. Soc. 82: 357–368.
CCDB · ipcn-api-dl — Nagl, W. & F. Ehrendorfer. 1974. DNA content, heterochromatin, mitotic index and growth in perennial and annual Anthemideae (Asteraceae). Pl. Syst. Evol. 123: 35–54.
CCDB · ipcn-api-dl — Zukowski, W. & T. Slowinska. 1979. Chromosome numbers of angiosperms of Northwestern Poland. Fragm. Florist. Geobot. 25: 477–483.
CCDB · ipcn-api-dl — Krasnikov. 2006. Chromosome numbers of some Artemisia species (Asteraceae) from Siberia. Bot. Žhurn. (Moscow & Leningrad) 91(3): 481–482.
CCDB · ipcn-api-dl — Stahevitch, A. E. & W. A. Wojtas. 1988. Chromosome numbers of some North American species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672–676.
CCDB · book-ipcn67-71 — HINDAKOVA, M., & F. CINCURA. 1967. Angaben Uber die Zahl und Morphologie der Chromosomen einiger Pf lanzenarten aus dem Territorium der Ostslowakei I. Acta Fae. Rerum Nat. Univ. Comenianae. Bot. 14: 181-227.
CCDB · book-ipcn67-71 — PODLECH, D., & A. DIETERLE. 1969. Chromosomenstudien an afghanischen Pflanzen. Candollea 24: 185-243.
CCDB · book-ipcn75-78 — Morton 1977
CCDB · book-ipcn75-78 — McArthur & Pope 1977
CCDB · book-ipcn73-74 — BHAT, B.K.,. S.K. BAKSHI, I M.K. KAUL. 1974. In IOPB chromosome numbi reports XLVI. Taxon 23: 801-812.
+36 more references
2n 362×CCDB · poland · CCDB · CromoCat 2015
CCDB · poland — Kreitschitz A., Valles J. 2003. New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobotanica 38, 333-343.
CCDB · CromoCat 2015 — Kreitschitz, A. & Vallès, J. (2003). New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobot. 38(3): 333–343.
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
n 921×CCDB · mediterranean · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +3
CCDB · mediterranean
CCDB · book-ipcn65 — Koul 1963-64c
CCDB · ipcn-api-dl — Vallés, J. & M. Torrell. 1995. Mediterranean chromosome number reports 5 (552--558). Fl. Medit. 5: 357–363.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Stahevitch, A. E. & W. A. Wojtas. 1988. Chromosome numbers of some North American species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672–676.
CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.
CCDB · Cave1958 — Khoshoo & Sobti 1958
CCDB · CromoCat 2015 — Afzal-Rafii, Z., Vianot, J., Ramade, M. & Bourreil, P. (1985). Analyse des caractères caryologiques et écologiques de quelques taxons dans les massifs du Luberon, de Lure et du Mont Ventoux. Rev. Cytol. Biol. Vég. Botaniste 8: 33-62.
CCDB · CromoCat 2015 — Agapova, N. D., Arkharova, K. B., Zemskova, L. I. & Tarvis, L. V. (1990). Numeri chromosomatum Magnoliophytorum Florae URSS. 1. A. Takhtajan Leningrad
CCDB · CromoCat 2015 — Khoshoo, Y. N. & Sobti, S. N. (1958). Cytology of Indian Species of Artemisia [sic]. Nature 181(4612): 853-854.
CCDB · CromoCat 2015 — Kuzmanov, B., Georgieva, S. & Nikolova, V. (1993b). Karyological study of Bulgarian Angiosperms. VII. Fitologija 44: 16-31.
CCDB · CromoCat 2015 — Mehra, P. N. & P. Remanandan. (1974). Cytological investigations on the Indian Compositae. II. Astereae, Heliantheae, Helenieae and Anthemideae. Caryologia 27(3): 255-284.
CCDB · CromoCat 2015 — Mendelak, M. & D. Schweizer. (1986). Giemsa C-Banded Karyotypes of Some Diploid Artemisia Species. Pl. Syst. Evol. 152: 195-210.
CCDB · CromoCat 2015 — Morton, J. K. (1981). Chromosome numbers in Compositae from Canada and the USA. Bot. J. Linn. Soc. 82: 357-368.
CCDB · CromoCat 2015 — Ouyahya, A. & J. Viano. (1988). Recherches cytogénétiques sur le genre Artemisia L. au Maroc. Bol. Soc. Brot. 61: 105-124.
CCDB · CromoCat 2015 — Podlech, D. & A. Dieterle. (1969). Chromosomenstudien an afghanischen Pflanzen. Candollea 24(2): 185-243.
CCDB · CromoCat 2015 — Semerenko, L. V. (1989). Chisla khromosom nekotorykh pretstavitelei semeistv Asteraceae, Fabaceae, Orchidaceae, Poaceae flory Berezinskogo Biosfernogo Zapovednika (BSSR). Bot. Žurn. 74(11): 1671-1673.
CCDB · CromoCat 2015 — Stahevitch, A. E. & W. A. Wotjas. (1988). Chromosome numbers of some North american species of Artemisia (Asteraceae). Canad. J. Bot. 66: 672-676.
CCDB · CromoCat 2015 — Vallés Xirau, J. & M. Torrell. (1995). Reports (552-558). Fl. Medit. 5: 357-363.
CCDB · CromoCat 2015 — Verlaque, R., M. Seidenbinder & P. Donadille. (1987a). Recherches cytotaxonomiques sur la spéciation en région méditerranéenne. I: Espèces à nombre chromosomique stable. Rev. Biol.-Écol. Méd. 10(4): 274-289.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
n 03×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Krasnikov (2006). Chromosome numbers of some Artemisia species (Asteraceae) from Siberia. Bot. Žhurn. 91(3): 481–482.
CCDB · CromoCat 2015 — Kreitschitz, A. & Vallès, J. (2003). New or rare data on chromosome numbers in several taxa of the genus Artemisia (Asteraceae) in Poland. Folia Geobot. 38(3): 333–343.
n 111×CCDB · ita-fl
CCDB · ita-fl — LOEVE A., SOLBRIG O.T. - 1964. IOPB chromosome number reports II.. Taxon , 13(6): 201-209.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~10.9 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin10.9 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type92 005 records
Wild obs. + sensor84 733
Museum / vouchered7 028
Cultivated / captive42
Other202
Origin
Native571
Introduced2 422
Range
Area of Occupancy AOO169 412 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 30 000≤1 km 8 789≤10 km 29 933>10 km 1 057
69 779 georeferenced · 14 954 without coordinates
Open the mapobservation + sensor84 733
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy47% within 1 km
≤100 m 761≤1 km 1 314≤10 km 2 108>10 km 211
4 394 georeferenced · 2 634 without coordinates
Open the institutions mapphysical evidence7 028
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy9% within 1 km
≤1 km 2≤10 km 9>10 km 12
23 georeferenced · 19 without coordinates
Open the mapnot free-living42
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions170 of 312 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 041 |
| LDlocation not on record | 316 |
| Moscow State Universitylocation not on record | 310 |
| Olocation not on record | 282 |
| BFLlocation not on record | 202 |
| BRNUlocation not on record | 157 |
| BIO-UNIPIlocation not on record | 150 |
| Kuopio, FI | 125 |
| MeiseBGlocation not on record | 118 |
| Uniwersytet Warszawskilocation not on record | 113 |
| Oskarshamn, SE | 106 |
| Tartu, EE | 97 |
| Oulu, FI | 92 |
| St. Paul, US | 91 |
| Barcelona, ES | 86 |
| SLU Artdatabankenlocation not on record | 84 |
| Zürich, CH | 77 |
| Görlitz, DE | 70 |
| Turku, FI | 67 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 66 |
| Adam Mickiewicz University in Poznańlocation not on record | 62 |
| BDBClocation not on record | 60 |
| Wuzhou, CN | 58 |
| València, ES | 58 |
| KMNlocation not on record | 55 |
| Zürich, CH | 54 |
| South Kensington, GB | 54 |
| Trondheim, NO | 51 |
| Madison, US | 48 |
| Jyväskylä, FI | 47 |
| Tempe, US | 47 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 44 |
| WTUlocation not on record | 44 |
| Salzburg, AT | 43 |
| WINlocation not on record | 41 |
| Tallinn, EE | 39 |
| Bronx, US | 39 |
| Provincia di Livornolocation not on record | 39 |
| Uppsala, SE | 34 |
| Entomological Society of Latvialocation not on record | 32 |
| BClocation not on record | 32 |
| Chapingo, MX | 31 |
| Wlocation not on record | 30 |
| Tula State Universitylocation not on record | 29 |
| GMBAlocation not on record | 28 |
| Missoula, US | 28 |
| Bozeman, US | 27 |
| Pullman, US | 27 |
| Vitoria, ES | 26 |
| Berlin, DE | 26 |
| MAlocation not on record | 24 |
| Moscow, US | 22 |
| Ann Arbor, US | 21 |
| University of Alberta Museumslocation not on record | 21 |
| Saint Louis, US | 19 |
| Bergen, NO | 19 |
| Bern, CH | 18 |
| Mexico City, MX | 18 |
| Chongqing Museumlocation not on record | 18 |
| Vancouver, CA | 17 |
| Burlington, US | 17 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 17 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 15 |
| TUR-Alocation not on record | 15 |
| Porto Alegre, BR | 15 |
| Helsinki, FI | 15 |
| Salamanca, ES | 14 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 13 |
| GJOlocation not on record | 13 |
| Saint John, CA | 13 |
| Philadelphia, US | 13 |
| New Haven, US | 13 |
| Mlocation not on record | 12 |
| Québec, CA | 12 |
| Corvallis, US | 12 |
| Christchurch, NZ | 12 |
| Logan, US | 12 |
| GZUlocation not on record | 11 |
| Chadron, US | 11 |
| San Isidro, AR | 11 |
| IDElocation not on record | 11 |
| PRClocation not on record | 10 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| Spearfish, US | 10 |
| Porvoo, FI | 10 |
| Montréal, CA | 9 |
| Bourges, FR | 9 |
| Madrid, ES | 8 |
| Yangling, CN | 8 |
| Uniwersytet Śląski w Katowicachlocation not on record | 8 |
| UFOPlocation not on record | 8 |
| Granada, ES | 8 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 8 |
| Urumqi, CN | 8 |
| Victoria, CA | 8 |
| Karlsruhe, DE | 8 |
| Wuhan, CN | 7 |
| Toronto, CA | 7 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 7 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 7 |
| Bloomington, US | 7 |
| Allentown, US | 7 |
| College of the Atlantic, Museumlocation not on record | 7 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 7 |
| Frankfurt am Main | 7 |
| Maringá, BR | 7 |
| Denver, US | 7 |
| Auckland, NZ | 7 |
| University of New Hampshirelocation not on record | 7 |
| Austin, US | 6 |
| Université Lavallocation not on record | 6 |
| Puebla, MX | 6 |
| Acadia Universitylocation not on record | 6 |
| Porrentruy, CH | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Uniwersytet Opolskilocation not on record | 6 |
| San Sebastián, ES | 6 |
| Brussel, BE | 6 |
| Stockholm, SE | 6 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 6 |
| Universidad de Antioquia (UdeA)location not on record | 6 |
| Canberra, AU | 6 |
| NMBU:MINAlocation not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 5 |
| CJBGlocation not on record | 5 |
| Guangzhou, CN | 5 |
| Flagstaff, US | 5 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 5 |
| DBF-NHMDlocation not on record | 5 |
| Córdoba, AR | 5 |
| Laboratory of Palaeontologylocation not on record | 5 |
| Wellington, NZ | 4 |
| Blumenau, BR | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Dekalb, US | 4 |
| University of Stellenboschlocation not on record | 4 |
| Miami, US | 4 |
| Green Bay, US | 4 |
| Hobart, AU | 4 |
| Pamplona, ES | 4 |
| Cascavel, BR | 4 |
| Paris, FR | 4 |
| Beijing, CN | 4 |
| Bangkok, TH | 4 |
| Durango, MX | 4 |
| Cheney, US | 4 |
| Provo, US | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Riobamba, EC | 3 |
| McWane Science Centerlocation not on record | 3 |
| Nijmegen, NL | 3 |
| Lincoln, US | 3 |
| Xining, CN | 3 |
| Fulda, DE | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| Jaén, ES | 3 |
| Tilburg, NL | 3 |
| Juriquilla, MX | 3 |
| Universidad de Caldas (UCaldas)location not on record | 3 |
| Guatemala City, GT | 3 |
| Whitehorse, CA | 3 |
| University of Wisconsinlocation not on record | 3 |
| SVK001location not on record | 3 |
| Philadelphia, US | 3 |
| Glarus, CH | 3 |
| Alicante, ES | 3 |
| Lanzhou, CN | 3 |
| Kew, GB | 3 |
| Boise, US | 3 |
| Frauenfeld, CH | 3 |
| Brookings, US | 2 |
| Davenport, US | 2 |
| Portland, US | 2 |
| Museum of the Rockieslocation not on record | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Herbario UTCEClocation not on record | 2 |
| Rotorua, NZ | 2 |
| Davis, US | 2 |
| Monastir, TN | 2 |
| Tuxtla Gutiérrez, MX | 2 |
| Riverside, US | 2 |
| nbflocation not on record | 2 |
| St. Augustine, TT | 2 |
| Montecillo, Texcoco, MX | 2 |
| Corrientes, AR | 2 |
| Sion, CH | 2 |
| Hazara Universitylocation not on record | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 2 |
| USFS/BHSClocation not on record | 2 |
| Nagano City, JP | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| Adelaide, AU | 2 |
| ESP149location not on record | 2 |
| SZUlocation not on record | 2 |
| Mérida, MX | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Badajoz, ES | 2 |
| Pocatello, US | 2 |
| BSBIlocation not on record | 2 |
| Universidad Industrial de Santander (UIS)location not on record | 2 |
| Columbia, US | 2 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 2 |
| Claremont, US | 2 |
| Foz do Iguaçu, BR | 2 |
| University of British Columbialocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Durham, US | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| PrivatHerblocation not on record | 1 |
| Mississippi State, US | 1 |
| Fargo, US | 1 |
| München, DE | 1 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 1 |
| Clemson, US | 1 |
| Pamplona, ES | 1 |
| H-Diaslocation not on record | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| NMWlocation not on record | 1 |
| UFBAlocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Torreón, MX | 1 |
| San Luis Obispo, US | 1 |
| ROM020location not on record | 1 |
| LPMMBHlocation not on record | 1 |
| Salvador, BR | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| ISAlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Podgorica, ME | 1 |
| Feira de Santana, BR | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| Sagamihara, JP | 1 |
| Sant Julià de Lòria, AD | 1 |
| WNNUlocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| Pomona Collegelocation not on record | 1 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 1 |
| Tapachula, MX | 1 |
| Musée des Confluenceslocation not on record | 1 |
| FLASlocation not on record | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Uberlândia, BR | 1 |
| Caldwell, US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Fribourg, CH | 1 |
| Taipei, TW | 1 |
| Valparaiso, CL | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Mount Annan, AU | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| UnBlocation not on record | 1 |
| Herbario Selva Central Oxapampa - estación biológica del Jardín Botánico de Missourilocation not on record | 1 |
| Cambridge, US | 1 |
| Chicago, US | 1 |
| SWlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Minot State Universitylocation not on record | 1 |
| Oswego, US | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| UoB-IBlocation not on record | 1 |
| Muzaffarabad, PK | 1 |
| Masindi, UG | 1 |
| Sevilla, ES | 1 |
| Institut fur Allgemeine Mikrobiologielocation not on record | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| ARM059location not on record | 1 |
| Forssa, FI | 1 |
| Dresden, DE | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Northridge, US | 1 |
| Chicago, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Pretoria, ZA | 1 |
| Universidade Federal de Goiáslocation not on record | 1 |
| Xiamen, CN | 1 |
| DULlocation not on record | 1 |
| Pelotas, BR | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| UTPLlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| UFVJMlocation not on record | 1 |
| Universiti Sains Malaysialocation not on record | 1 |
| URCAlocation not on record | 1 |
| Tlalnepantla, MX | 1 |
| Firenze, IT | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Kingston, US | 1 |
| Odawara, JP | 1 |
| UFRRJlocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| Santa Barbara, US | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Göteborg, SE | 1 |
| Buenos Aires, AR | 1 |
| Córdoba, ES | 1 |
| ESP109location not on record | 1 |
312 institutions · 6 039 of 7 028 vouchered records shown · 919 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA22 detections
Where the DNA of Artemisia absinthium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found22
Studies independent surveys1
Countries8
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 22 detections have coordinates
Open the map8 countries0
Disturbed areas along the highway.Botanic Garden
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.7 °C 10.9–18.3
Seasonal swing summer↔winter18.3 °C
Max temp (day)17.9 °C 14.8–24.0
Min temp (night)9.50 °C 6.00–14.2
Precipitation66.9 mm/mo 31.7–108
Air humidity59.6 % 48.3–63.5
Moisture balance-27.2 mm/mo
Vapour deficit681 Pa 466–1,019
Wind speed4.20 m/s
Cloud cover41.5 % 31.9–48.8
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.