Artedia squamata

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Artedia

At a glance

Occurrence records1 312

Data sources10

Biological traits12

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Artedia squamata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 312 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF1 312 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT1.2 Gbp

01Narrative

Artedia est un genre de plantes à fleurs annuelles de la famille des Apiaceae, ne comprenant qu'une seule espèce, Artedia squamata, originaire du Moyen-Orient.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass8.61 mg

⚠ sources differ — TRY: 8.61 mg · GIFT: 9.27 mg

Seed mass max14.32 mg

Seed mass min5.2 mg

Life cycle & reproduction3

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Aquaticterrestrial

Climatesubtropical

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artedia squamata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences5

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSAF077114.1 ↗215 bp

ACGT

ATCGTGTTGCCACCTGACCAAACATCTCTCATGGGGACGTTTTGGTTGGGGGCGGATATTGGCCTCCCGTGCGTTGTTTGCGCGGCTGGC …

Artedia squamata internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Artedia squamata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 173 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Artedia squamata1.17 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidy2× diploid · measured

Chromosome records16–162n range16median16mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 163×GoaT · Kew Plant DNA C-values Database · CCDB · book-ipcn67-71 · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-ipcn67-71 — ENGSTRAND, L. 1970. Studies in the Aegean flora XVIII. Notes and chromosome numbers in Aegean Umbelliferae. Bot. Notiser 123: 384-393.

CCDB · kew — Le Coq C et al. 1978. La quantite d'ADN nucleaire & la garniture chromosomique chez quelques ombelliferes. Actes 2e Sympos. Internat. sur Ombelliferes. 'Contributions pluridisciplinairesa la systematique'. Perpignan 281-291.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type1 312 records

Wild obs. + sensor1 276

Museum / vouchered33

Other3

Range

Area of Occupancy AOO2 596 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy52% within 1 km

≤100 m 129≤1 km 37≤10 km 146>10 km 6

318 georeferenced · 958 without coordinates

Open the mapobservation + sensor1 276

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2≤10 km 2

5 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence33

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	11
Moscow State Universitylocation not on record	5
Kew, GB	3
LDlocation not on record	3
Rishon Le Zion, IL	2
Universidad de Caldas (UCaldas)location not on record	2
Flagstaff, US	1
Universidad del Quindío (UniQuindío)location not on record	1
Berlin, DE	1
Wlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
València, ES	1
Bratislava, SK	1

13 institutions · 33 of 33 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Artedia squamata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Artedia squamata

At a glance

Sources10 archives

Size & morphology3

Life cycle & reproduction3

Diet & foraging1

Habitat & environment4

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 312 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 312 records