Artanema fimbriatum

D.Don · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Linderniaceae/Artanema

At a glance

Occurrence records704

Data sources5

Biological traits31

DNA specimens1

eDNA detections1

Sources5 archives

Databases and archives Artanema fimbriatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility704 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources31 traits

Occurrence & distributionGBIF704 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology13

Fruit length8.25 mm

Fruit width7.75 mm

Leaf length60 mm

Leaf length max80 mm

Leaf length min40 mm

Leaf width20 mm

Leaf width max30 mm

Leaf width min10 mm

Petiole length0.6 cm

Plant height0.6 m

Plant height max0.6 m

Plant height min0.3 m

Seed mass0.066 mg

Life cycle & reproduction6

Dehiscencedehiscent

Flowering timeyynnnnnnyyyy

Life spanshort_lived_perennial

⚠ sources differ — AusTraits: short_lived_perennial · GIFT: perennial

Lifespan years10 years

Resprouting capacityfire_killed

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeelliptical narrowly_ovate

Woodinessvariable

⚠ sources differ — TRY: non-woody/woody · AusTraits: herbaceous · GIFT: non-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Artanema fimbriatum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

matKMH212302.1 ↗757 bpAustralia

ACGT

ATTCTTGCTTAACGAGTATTGGAATTGGAATAGTCTTATTACTCCAAAGAAAGCCAGTTCCTCTTTTTCAAAAAAAAATCAAAGATTATT …

Artanema fimbriatum voucher BM Waterhouse 6375 maturase K gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3

plant barcode

08Occurrence & distribution

Record type704 records

Wild obs. + sensor419

Museum / vouchered250

Cultivated / captive2

Other33

Origin

Native36

Range

Area of Occupancy AOO1 644 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 229≤1 km 63≤10 km 23>10 km 23

338 georeferenced · 81 without coordinates

Open the mapobservation + sensor419

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 50≤1 km 41≤10 km 78>10 km 49

218 georeferenced · 32 without coordinates

Open the institutions mapphysical evidence250

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 1 without coordinates

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	109
Museo Entomologico de Leonlocation not on record	47
Mount Annan, AU	36
Smithfield, AU	31
Canberra, AU	10
NSW Dept of Planning, Industry and Environmentlocation not on record	3
Kew, GB	3
Armidale, AU	3
John T. Waterhouse Herbariumlocation not on record	2
Adelaide, AU	2
James Cook Townsvillelocation not on record	1
Palmerston, AU	1

12 institutions · 248 of 250 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Artanema fimbriatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)