Arrhenia epichysium

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hygrophoraceae/Arrhenia

At a glance

Occurrence records1 412

Data sources9

Biological traits0

DNA specimens4

eDNA detections5

Sources9 archives

Databases and archives Arrhenia epichysium's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 412 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 412 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Arrhenia epichysium is a species of agaric fungus in the family Hygrophoraceae. It is found in Asia, Europe, and North America. The fruit body has small brown to dark gray caps measuring 1 – in diameter. The cap color changes to light gray to tan when it is dry. Gills are narrow and thin, placed together closely, and decurrently attached to the stipe. The spores are smooth and ellipsoid, measuring 6–7.5 μm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arrhenia epichysium has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes1

GenBank sequences10

eDNA detections5

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ615510.1 ↗641 bpUSA · 2023

ACGT

GTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTTAAAAAAGGTTGTTGCTGGCTTCTCGGAGCATGTGCACA …

Arrhenia epichysium isolate OMDL iNat # 188647914 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS10

fungal barcode

08Occurrence & distribution

Record type1 412 records

Wild obs. + sensor1 140

Museum / vouchered265

Cultivated / captive1

Other6

Range

Area of Occupancy AOO4 324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 436≤1 km 186≤10 km 170>10 km 56

848 georeferenced · 292 without coordinates

Open the mapobservation + sensor1 140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy80% within 1 km

≤100 m 90≤1 km 51≤10 km 33>10 km 2

176 georeferenced · 89 without coordinates

Open the institutions mapphysical evidence265

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions26 of 43 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	39
SLU Artdatabankenlocation not on record	19
IB FRC Komi SC UB RASlocation not on record	13
Helsinki, FI	13
Chicago, US	10
Universidade de Lisboa, Museu Bocagelocation not on record	9
Göteborg, SE	8
Trondheim, NO	8
Université de Montréal Biodiversity Centrelocation not on record	7
Philadelphia, US	6
BDBClocation not on record	5
St. Paul, US	5
BRNUlocation not on record	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	5
TENN-Flocation not on record	4
Toronto, CA	3
Salzburg, AT	3
nsnflocation not on record	3
WU-MYClocation not on record	3
TROMlocation not on record	3
Turku, FI	3
CA	2
Osaka, JP	2
Ann Arbor, US	2
TUR-Alocation not on record	2
Denver, US	2
Cincinnati, US	2
Uppsala, SE	2
Santa Cruz, US	2
Karlsruhe, DE	2
Stockholm, SE	1
Vancouver, CA	1
Surgut State Universitylocation not on record	1
Oulu, FI	1
Tartu, EE	1
Gijón, ES	1
Helsinki, FI	1
Warsaw, PL	1
Metsähallituslocation not on record	1
Görlitz, DE	1
Copenhagen, DK	1
Acadia Universitylocation not on record	1
Provincia di Livornolocation not on record	1

43 institutions · 205 of 265 vouchered records shown · 60 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Arrhenia epichysium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

At a glance

Sources9 archives

At a glance

Record type1 412 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions26 of 43 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 412 records