Arrhenia acerosa

(Fr.) Kühner · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Hygrophoraceae/Arrhenia

At a glance

Occurrence records1 251

Data sources8

Biological traits0

DNA specimens0

eDNA detections47

Sources8 archives

Databases and archives Arrhenia acerosa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 251 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI47 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 251 records

Environmental DNA5 datasets · 11 countries47 detections

DNA & barcodingNCBIsequences

01Narrative

Arrhenia acerosa, commonly known as the moss oysterling, is a species of agaric fungus in the family Hygrophoraceae. It is found in Europe, where it grows on mosses.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arrhenia acerosa has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences9

eDNA detections47

Countries11

The DNA barcodea real sequence read deposited for this species

ITSMT747294.1 ↗216 bp

ACGT

GTTGCTGGTCCTCCGGGACATGTGCACACCTTCGGTCGACATCCTTCACACCCCTGTGCACCTCTGCGTGTGGCTTCCCCCTCGCTTCGG …

Arrhenia acerosa voucher FRI<AUST>:219 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type1 251 records

Wild obs. + sensor881

Museum / vouchered368

Other2

Range

Area of Occupancy AOO3 628 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 205≤1 km 50≤10 km 512>10 km 46

813 georeferenced · 68 without coordinates

Open the mapobservation + sensor881

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 85≤1 km 95≤10 km 50>10 km 7

237 georeferenced · 131 without coordinates

Open the institutions mapphysical evidence368

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Olocation not on record	72
TROMlocation not on record	36
Trondheim, NO	27
Copenhagen, DK	23
Kew, GB	16
Oulu, FI	12
Helsinki, FI	11
nsnflocation not on record	9
	8
Görlitz, DE	7
Uppsala, SE	7
Vancouver, CA	6
Göteborg, SE	6
Philadelphia, US	6
WTUlocation not on record	5
WU-MYClocation not on record	5
BDBClocation not on record	4
Museo Entomologico de Leonlocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Karlsruhe, DE	4
Chicago, US	4
LDlocation not on record	3
Turku, FI	3
Joensuu, FI	3
MeiseBGlocation not on record	3
San Sebastián, ES	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
Toronto, CA	2
Mlocation not on record	2
Universidade de Lisboa, Museu Bocagelocation not on record	2
Zürich, CH	2
Bronx, US	2
CJBGlocation not on record	1
Gijón, ES	1
Stockholm, SE	1
Vitoria, ES	1
Staten Island, US	1

37 institutions · 308 of 368 vouchered records shown · 60 without an institution code

09Environmental DNA47 detections

Where the DNA of Arrhenia acerosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found47

Studies independent surveys5

Countries11

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 47 detections have coordinates

Open the map11 countries0

AustralasiaAfrotropicPalearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature30.0 °C 15.0–35.0

pH5.90 4.20–8.70

Conductivity19.0 µS/cm 10.0–219

Organic carbon1.00 % 0.22–5.38

Water content7.20 % 0.236–74.4

Nitrate-N1.50 mg/kg 1.00–2.00

Phosphorus53.0 mg/kg 2.00–113

Clay3.42 % 0.99–52.0

Sand95.1 % 33.7–98.1

Depth0 m 0–0.2

SoilTenosolsChromosolsSodosolAnthroposolsRudosolPodosol

22 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 6.70–18.2

Seasonal swing summer↔winter12.2 °C

Max temp (day)18.0 °C 9.40–22.3

Min temp (night)10.7 °C 3.00–14.8

Precipitation82.7 mm/mo 18.6–121

Air humidity57.7 % 51.2–65.6

Moisture balance-4.20 mm/mo -85.3–54.2

Vapour deficit724 Pa 341–853

Wind speed3.60 m/s 1.10–4.50

Cloud cover37.3 % 9.30–46.7

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Arrhenia acerosa

At a glance

Sources8 archives

At a glance

Record type1 251 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions23 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 251 records