Arrhenatherum kotschyi

Boiss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Arrhenatherum

At a glance

Occurrence records45

Data sources9

Biological traits15

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Arrhenatherum kotschyi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility45 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF45 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

01Narrative

حسيك كوتشي هو نوع نباتي يتبع جنس الحسيك من فصيلة النجيلية.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.6 m

Plant height min0.3 m

Life cycle & reproduction5

Flowering endJun

Flowering startJun

Life formperennial

Life spanperennial

Lifeform raunkiaer detailedhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTmountains

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arrhenatherum kotschyi has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences4

eDNA detections3

Countries3

The DNA barcodea real sequence read deposited for this species

ITSAJ632232.1 ↗294 bpIraq

ACGT

CATTGTCGTGACCCTAACCAAAACAGACCGCGCACGCGTAATCCAGCCTGTCTGCAGCGGCGGCACTATCCGTCACTCGGCCAAGTCCTC …

Arrhenatherum kotschyi 18S rRNA gene (partial), 5.8S rRNA gene (partial) and ITS1, isolate KOTARR-1

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arrhenatherum kotschyi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidypolyploid inferred

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.

CCDB · ipcn-api-dl — Goukasian. 2002. Karyosystematic study of the genera Arrhenatherum Beauv. (Poaceae) of the Armenian flora. Fl. Rastitel'n. Rastitel'n. Resursy Armenii 14: 63–64.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type45 records

Wild obs. + sensor13

Museum / vouchered32

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤1 km 1≤10 km 3

6 georeferenced · 7 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 3≤1 km 3≤10 km 2

8 georeferenced · 24 without coordinates

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wlocation not on record	9
Berlin, DE	6
Moscow State Universitylocation not on record	2
Bratislava, SK	2
BClocation not on record	2
Rishon Le Zion, IL	1
MAlocation not on record	1
Kew, GB	1
València, ES	1
South Kensington, GB	1

10 institutions · 26 of 32 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Arrhenatherum kotschyi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 7.60–22.0

Seasonal swing summer↔winter27.8 °C

Max temp (day)27.6 °C 12.1–27.6

Min temp (night)13.9 °C 1.20–13.9

Precipitation5.50 mm/mo 5.50–37.6

Air humidity39.8 % 39.8–51.2

Moisture balance-124 mm/mo -124–-42.9

Vapour deficit1,940 Pa 753–1,940

Wind speed2.40 m/s 1.70–2.40

Cloud cover21.6 % 21.6–29.0

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)