Arrhenatherum elatius
(L.) P.Beauv. ex J.Presl & C.Presl · speciesAt a glance
Occurrence records847 800
Data sources14
Biological traits145
DNA specimens109
eDNA detections224
Sources14 archives
Databases and archives Arrhenatherum elatius's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility847 800 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI224 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics109 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources145 traits
Chemical compositionLOTUS14 compounds
Occurrence & distributionGBIF847 800 records
Environmental DNA3 datasets · 22 countries224 detections
DNA & barcodingBOLD · NCBI109 specimens
Genome at a glanceCCDB · GoaT7.9 Gbp
01Narrative
Arrhenatherum elatius, with the common names bulbous oat grass, false oat-grass, tall oat-grass, tall meadow oat, onion couch and tuber oat-grass, is a species of perennial grass, native to Europe, western Asia, and northern Africa. This bunchgrass is often used as an ornamental grass and is sometimes marketed as "cat grass". It is native to Europe but can be found elsewhere as an introduced species. It is found especially in prairies, at the side of roads and in uncultivated fields. The bulbous subspecies can be a weed of arable land. It is palatable grass for livestock and is used both as forage (pasture) and fodder (hay and silage).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology26
Inflorescence length max30 cm
Inflorescence length min10 cm
Leaf length180 mm
Leaf length max300 mm
Leaf length min1 mm
Leaf mass30.65 mg
Leaf size1 146 mm²
⚠ sources differ — TRY: 1 146 mm² · AusTraits: 819 mm² · LEDA: 1 223 mm² · GIFT: 1 223 mm²
Leaf width4 mm
⚠ sources differ — AusTraits: 4 mm · GIFT: 7 mm
Leaf width max10 mm
Leaf width min1 mm
Plant height1.19 m
⚠ sources differ — GIFT: 1.19 m · AusTraits: 1.25 m · LEDA: 1.35 m · USDA: 1.22 m · TRY: 0.5 m
Plant height generative0.963 m
Plant height max1.5 m
Plant height min0.5 m
Seed length3.71 mm
⚠ sources differ — TRY: 3.71 mm · GIFT: 3.2 mm
Seed length max3.2 mm
Seed length min3.2 mm
Seed mass2.73 mg
⚠ sources differ — TRY: 2.73 mg · LEDA: 2.77 mg · GIFT: 2.59 mg
Seed mass max3.76 mg
Seed mass min1.6 mg
Seed volume3 mm³
Seed volume max3 mm³
Seed volume min3 mm³
Seed width1 mm
Seed width max1 mm
Seed width min1 mm
Life cycle & reproduction36
After harvest regrowth rateModerate
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flowering endJul
Flowering startJun
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formperennial
Life spanperennial
Lifespan categoryModerate
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Resprouting capacityresprouts
Seed number12 580
Seed spread rateModerate
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max3 000 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: grass
Growth form USDABunch
Habitat GIFTCampo Limpo
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Leaf shapelinear
Low growing grassNo
Mycorrhiza typeAMNM
Root depth min14 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry28
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min118 days
Leaf C:N ratio15.51 g/g
Leaf c444 mg/g
Leaf dry-matter content (LDMC)277 mg/g
⚠ sources differ — TRY: 277 mg/g · LEDA: 300 mg/g
Leaf n29.1 mg/g
Leaf p2.74 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max47.5 in
Precipitation min32 in
Protein potentialMedium
Salinity toleranceMedium
Seed longevity index0
Shade toleranceLow
Soil pH max7.15 pH
Soil pH min5.15 pH
Specific leaf area (SLA)26.1 mm²/mg
⚠ sources differ — TRY: 26.1 mm²/mg · LEDA: 29.04 mm²/mg · GIFT: 28.25 mm²/mg
Temperature min-40.5 °F
Wood density161 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound189 120 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencepanicle
Seeds per fruit101-1000
03Chemical composition14 compounds
Compounds documented for Arrhenatherum elatius across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Flavones10
Oleanane triterpenoids4
Documented compounds14 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| 5,7-dihydroxy-2-(4-hydroxyphenyl)-8-[(2S,4R,5S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-6-[(2S,4S,5R)-3,4,5-trihydroxyoxan-2-yl]chromen-4-one | present | LOTUS | |
| 7-O-Beta-D-Glucopyranoside | present | LOTUS | |
| Apiumetrin | present | LOTUS | |
| Avenacin A 1 | present | LOTUS | |
| avenacin A-2 | present | LOTUS | |
| avenacin B-1 | present | LOTUS | |
| Avenacin B-2 | present | LOTUS | |
| Isoorientin 7-O-(6'''-O-(E)-feruloyl)glucoside | present | LOTUS | |
| Isoscoparin | present | LOTUS | |
| Isovitexin | present | LOTUS |
05DNA & barcoding109 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arrhenatherum elatius has left across the world's sequence archives.
At a glance
DNA specimens109
Marker genes11
GenBank sequences9
eDNA detections224
Countries22
The DNA barcodea real sequence read deposited for this species
ATCGCGTCGCCCCCCATCATTGGGAGTAGGATGCGGCATGTGGCCTCCCGTCACGCAGGGGGCGGTGGGCCGAAGATATGGCTGCCGGCG …
Arrhenatherum elatius clone POTU_54 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL2★rbcLa★ITS6★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Arrhenatherum elatius carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size7 941 359 999 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Arrhenatherum elatius7.94 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records14–562n range28median28mode79records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2865×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +21
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Curran, P.L. Irish Naturalists' J. 16: 7-9 (1968)
CCDB · brit-fl — Pfitzenmeyer, C.D.C. (1959)
CCDB · brit-fl — Jones, K. (1969)
CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)
CCDB · iber-fl — Revisin del gnero Arrhenatherum Beauv. (Gramineae) en la pennsula Ibrica. Romero Zarco, C.Acta Bot. Malacitana10: 123-154(1985).
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. I. Gramineae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 77-103(1973).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4516
CCDB · fl-europaea — LOve & LOve, 1956
CCDB · fl-europaea — Fernandes & Queiros
CCDB · poland — Skali?ska M., Pogan E., Czapik R. et al. 1978. Further studies in chromosome numbers of Polish Angiosperms. Twelfth contribution. Acta Biol. Cracov. Ser. Bot. 21, 31-63.
CCDB · mediterranean
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sorokin, S. N. 1991. Chromosome numbers in the members of the family Poaceae from the European part of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1331–1332.
CCDB · ipcn-api-dl — Sorokin, S. N. 1993. Karyosystematic study of some members of the tribe Aveneae (Poaceae). Bot. Žhurn. (Moscow & Leningrad) 78(4): 36–47.
CCDB · ipcn-api-dl — Nazarova, E. & A. Goukasian. 1995. Mediterranean chromosome number reports 5 (528--542). Fl. Medit. 5: 340–345.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Skalinska, M. 1978. Further studies in chromosome numbers of Polish angiosperms. Twelfth contribution. Acta Biol. Cracov., Ser. Bot. 21: 31–63.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · ipcn-api-dl — Ghukasyan. 2004. Extent of karyological study of Armenian grasses (Poaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 15: 85–89.
CCDB · ipcn-api-dl — Goukasian. 2002. Karyosystematic study of the genera Arrhenatherum Beauv. (Poaceae) of the Armenian flora. Fl. Rastitel'n. Rastitel'n. Resursy Armenii 14: 63–64.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn67-71 — CURRAN, P.L. 1968. Chromosome numbers of sone Irish plants. Irish Naturalists' J. 16: 7-9.
CCDB · book-ipcn67-71 — DELAY, J. 1970. Polyploidie dans les peuplements naturals. Inf. Ann. Caryosyst. et Cytogenet. 4: 21-24.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-ipcn75-78 — Skalinska et al. 1978
CCDB · book-ipcn75-78 — Hindakova 1978
CCDB · book-northern-plants — Rutland 1941.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dj spermatophyta de Portugal. I. Gramineae, Supl. I. Bol. Soc. Brot. I 4 7 ( Ser . 2 ) : 7 7- 1 0 3 .
CCDB · book-indian_vol2 — Aase, H.C. & Powers, L.R. 1926 ; Avdulov, N.P. (Fedorov) ; Nakajima, G. 1931 ; Guinochet, M. 1943 ; Parodi, L.R. 1946; Delay, C. 1947 ; P6lya, L. 1949 ; Hubbard, C. E. 1954 ; Toteoka, T. 1954 ; Shibata, K. 1956 ; Morrison, J.W. & Rajhathy, T. 1960b ; Pfitzenmeyer, C.D.C. 1962 ; Curran, P.L. 1968 ; Kozuharov, S.I. & Kuzmanov, B.A. 1968 ; Delay, J. 1970b ; Majovsky, J. et al. 1970b
CCDB · eflora
CCDB · book-atlas-flowering-plants — Avdulov 1931
CCDB · book-atlas-flowering-plants — Rutland 1941
CCDB · kew — Grime JP, Mowforth MA. 1982. Variation in genome size - an ecological interpretation. Nature 299: 151-153.
+23 more references
2n 1410×CCDB · iber-fl · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +2
CCDB · iber-fl — Revisin del gnero Arrhenatherum Beauv. (Gramineae) en la pennsula Ibrica. Romero Zarco, C.Acta Bot. Malacitana10: 123-154(1985).
CCDB · book-ipcn65 — Hill 1965
CCDB · ipcn-api-dl — Favarger, C., N. Galland & P. Kupper. 1979. Recherches cytotaxonomiques sur la flore orophile du Maroc. Nat. Monspel., Sér. Bot. 29: 1–64.
CCDB · book-indian_vol2 — Hill, H.D. 1965
CCDB · CromoCat 2015 — Favarger, C., Galland, N. & Küpfer, P. (1979). Recherches cytotaxonomiques sur la flore orophile du Maroc. Naturalia Monspel., Sér. Bot. 29: 1-64.
CCDB · CromoCat 2015 — Chopanov, P. & Yurtsev, B. (1976). Chromosome numbers of some grasses of Turkmenia. II. Bot. Žurn. 61: 1240-1244.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990b). Contribucion al conocimiento cariológico de las Paoceae en Extremadura (España). I. Bol. Soc. Brot. 63: 29-66.
CCDB · CromoCat 2015 — Mehra, P. N. & M. L. Sharma. (1975a). Cytological studies in some central and Eastern Himalayan grasses. Cytologia 40: 441-452.
CCDB · CromoCat 2015 — Romero Zarco, C. (1985a). Revisión del género Arrhenatherum Beauv. (Gramineae) en la Península Ibérica. Acta Bot. Malac. 10: 123-154.
2n 422×CCDB · book-indian_vol2 · CCDB · Cave1962
CCDB · book-indian_vol2 — Bowden, W.M. & Senn, H.A. 1962
CCDB · Cave1962 — Bowden & Senn 1962
2n 401×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Davies, J.G. 1927
2n 561×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Mehra, P.N. & Sharma, M.L. 1975c
n 1411×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Revisin del gnero Arrhenatherum Beauv. (Gramineae) en la pennsula Ibrica. Romero Zarco, C.Acta Bot. Malacitana10: 123-154(1985).
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). I. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 29-66(1990).
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, R. Tormo, A. Muñoz, M. C. Viera, J. Carrasco, A. Ortega & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., sér. 2 63: 153–205.
CCDB · CromoCat 2015 — Favarger, C., Galland, N. & Küpfer, P. (1979). Recherches cytotaxonomiques sur la flore orophile du Maroc. Naturalia Monspel., Sér. Bot. 29: 1-64.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990b). Contribucion al conocimiento cariológico de las Paoceae en Extremadura (España). I. Bol. Soc. Brot. 63: 29-66.
CCDB · CromoCat 2015 — Devesa, J.A., Ruiz, T., Tormo, R., Muñoz, A., Viera, M. C., Carrasco, J., Ortega, A. & Pastor, J. (1990). Contribución al conocimiento cariológico de las Poaceae en Extremadura II. Bol. Soc. Brot., Sér. 2 63:153-205
CCDB · CromoCat 2015 — Romero Zarco, C. (1985a). Revisión del género Arrhenatherum Beauv. (Gramineae) en la Península Ibérica. Acta Bot. Malac. 10: 123-154.
n 79×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). II. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 153-205(1990).
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, A. Ortega, J. P. Carrasco, M. C. Viera, R. Torno & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura (Espana)---I. Bol. Soc. Brot., sér. 2 63: 29–66.
CCDB · CromoCat 2015 — Favarger, C., Galland, N. & Küpfer, P. (1979). Recherches cytotaxonomiques sur la flore orophile du Maroc. Naturalia Monspel., Sér. Bot. 29: 1-64.
CCDB · CromoCat 2015 — Chopanov, P. & Yurtsev, B. (1976). Chromosome numbers of some grasses of Turkmenia. II. Bot. Žurn. 61: 1240-1244.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990b). Contribucion al conocimiento cariológico de las Paoceae en Extremadura (España). I. Bol. Soc. Brot. 63: 29-66.
CCDB · CromoCat 2015 — Mehra, P. N. & M. L. Sharma. (1975a). Cytological studies in some central and Eastern Himalayan grasses. Cytologia 40: 441-452.
CCDB · CromoCat 2015 — Romero Zarco, C. (1985a). Revisión del género Arrhenatherum Beauv. (Gramineae) en la Península Ibérica. Acta Bot. Malac. 10: 123-154.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990a). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). II. Bol. Soc. Brot. 63: 153-205.
n 281×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Mehra & Sharma 1975b
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
08Occurrence & distribution
Record type847 800 records
Wild obs. + sensor829 531
Museum / vouchered14 328
Cultivated / captive1 257
Other2 684
Origin
Native47 193
Introduced100
Range
Area of Occupancy AOO560 916 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy41% within 1 km
≤100 m 121 545≤1 km 153 681≤10 km 384 801>10 km 3 922
663 949 georeferenced · 165 582 without coordinates
Open the mapobservation + sensor829 531
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 1 070≤1 km 2 582≤10 km 6 118>10 km 774
10 544 georeferenced · 3 784 without coordinates
Open the institutions mapphysical evidence14 328
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 10>10 km 13
23 georeferenced · 1 234 without coordinates
Open the mapnot free-living1 257
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions170 of 313 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 933 |
| Helsinki, FI | 452 |
| LDlocation not on record | 384 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 380 |
| Olocation not on record | 348 |
| Görlitz, DE | 287 |
| Salzburg, AT | 237 |
| Bergen, NO | 232 |
| Moscow State Universitylocation not on record | 206 |
| Trondheim, NO | 180 |
| Uniwersytet Warszawskilocation not on record | 170 |
| MeiseBGlocation not on record | 160 |
| Tartu, EE | 139 |
| TROMlocation not on record | 121 |
| Karlsruhe, DE | 120 |
| KMNlocation not on record | 119 |
| Chongqing Museumlocation not on record | 109 |
| Berlin, DE | 101 |
| Turku, FI | 94 |
| BFLlocation not on record | 93 |
| Adam Mickiewicz University in Poznańlocation not on record | 89 |
| Philadelphia, US | 88 |
| Bronx, US | 87 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 84 |
| Oskarshamn, SE | 82 |
| Uppsala, SE | 76 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 76 |
| SLU Artdatabankenlocation not on record | 72 |
| BDBClocation not on record | 69 |
| BClocation not on record | 64 |
| Provincia di Livornolocation not on record | 59 |
| BRNUlocation not on record | 59 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 59 |
| Lausanne, CH | 58 |
| CICYTEXlocation not on record | 58 |
| Tallinn, EE | 58 |
| Wlocation not on record | 56 |
| South Kensington, GB | 56 |
| Kuopio, FI | 51 |
| Oulu, FI | 51 |
| Shinshu Universitylocation not on record | 47 |
| WTUlocation not on record | 43 |
| Bern, CH | 40 |
| GJOlocation not on record | 39 |
| UniKSlocation not on record | 37 |
| Barcelona, ES | 35 |
| Wellington, NZ | 33 |
| MAlocation not on record | 31 |
| Auckland, NZ | 30 |
| València, ES | 30 |
| Davis, US | 29 |
| TUR-Alocation not on record | 28 |
| New Haven, US | 27 |
| Christchurch, NZ | 26 |
| University of Stellenboschlocation not on record | 26 |
| CZE082location not on record | 24 |
| HUN003location not on record | 22 |
| Salamanca, ES | 22 |
| UGentlocation not on record | 22 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 21 |
| Moscow, US | 21 |
| University of New Hampshirelocation not on record | 21 |
| Ann Arbor, US | 19 |
| Uniwersytet Jagiellońskilocation not on record | 19 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 18 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 17 |
| Provo, US | 17 |
| Frankfurt am Main | 17 |
| Victoria, CA | 17 |
| Zürich, CH | 16 |
| Jyväskylä, FI | 16 |
| Museo Entomologico de Leonlocation not on record | 16 |
| Saint Louis, US | 16 |
| Arcata, US | 16 |
| DBF-NHMDlocation not on record | 16 |
| Vancouver, CA | 15 |
| Allentown, US | 15 |
| CJBGlocation not on record | 15 |
| Mlocation not on record | 15 |
| Claremont, US | 14 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 13 |
| Williamsburg, US | 13 |
| College of the Atlantic, Museumlocation not on record | 12 |
| Flagstaff, US | 12 |
| BSBIlocation not on record | 12 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 12 |
| Denver, US | 12 |
| Natural History Museum Rotterdamlocation not on record | 11 |
| Dresden, DE | 11 |
| College Park, US | 11 |
| Pullman, US | 11 |
| Sanda, JP | 11 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 11 |
| Philadelphia, US | 11 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 11 |
| International Salmonella Centre (W.H.O.)location not on record | 10 |
| Porrentruy, CH | 10 |
| Canberra, AU | 10 |
| Madrid, ES | 10 |
| Canadian Department of Agriculturelocation not on record | 10 |
| Paris, FR | 10 |
| POL003location not on record | 9 |
| Boise, US | 9 |
| Tacoma, US | 9 |
| Bozeman, US | 9 |
| Uniwersytet Śląski w Katowicachlocation not on record | 8 |
| Porvoo, FI | 8 |
| Millersville, US | 8 |
| Pocatello, US | 8 |
| Logan, US | 8 |
| Mount Annan, AU | 8 |
| Angwin, US | 8 |
| Tilburg, NL | 8 |
| SZUlocation not on record | 8 |
| Ashland, US | 7 |
| Uniwersytet Opolskilocation not on record | 7 |
| Forssa, FI | 7 |
| Odawara, JP | 7 |
| Glarus, CH | 7 |
| GZUlocation not on record | 7 |
| ASUlocation not on record | 7 |
| KIRMlocation not on record | 7 |
| Acadia Universitylocation not on record | 7 |
| Kew, GB | 7 |
| Staten Island, US | 6 |
| Hobart, AU | 6 |
| Pamplona, ES | 6 |
| Albuquerque, US | 6 |
| Riverside, US | 6 |
| Dekalb, US | 6 |
| Chapel Hill, US | 6 |
| US | 6 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 6 |
| Pamplona, ES | 6 |
| Nagano City, JP | 5 |
| Urumqi, CN | 5 |
| Cheney, US | 5 |
| Sagamihara, JP | 5 |
| Caldwell, US | 5 |
| Tomioka, JP | 5 |
| Corvallis, US | 5 |
| Zürich, CH | 5 |
| ROM007location not on record | 5 |
| Portland, US | 5 |
| Missoula, US | 5 |
| San Angelo, US | 5 |
| Bangkok, TH | 5 |
| CASlocation not on record | 5 |
| Burlington, US | 4 |
| Bourges, FR | 4 |
| Garðabær, IS | 4 |
| Hamilton, US | 4 |
| Durban, ZA | 4 |
| Santa Barbara, US | 4 |
| Knoxville, US | 4 |
| nbflocation not on record | 4 |
| Columbia, US | 4 |
| IDElocation not on record | 4 |
| UIBlocation not on record | 4 |
| Bend, US | 4 |
| Edinburgh, GB | 4 |
| Sevilla, ES | 4 |
| Orem, US | 4 |
| Naturalis Biodiversity Centerlocation not on record | 4 |
| Jagiellonian Universitylocation not on record | 4 |
| EL PASO, US | 4 |
| Tromso University Museumlocation not on record | 4 |
| Parkville, AU | 4 |
| QVMAGlocation not on record | 4 |
| Armidale, AU | 4 |
| ROM023location not on record | 4 |
| Akita Prefectural Museumlocation not on record | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Norfolk, US | 3 |
| Otaru, JP | 3 |
| SVN019location not on record | 3 |
| Pretoria, ZA | 3 |
| National Museum Waleslocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Taipei, TW | 3 |
| Xiamen, CN | 3 |
| Whitehorse, CA | 3 |
| KR | 3 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 3 |
| South African National Biodiversity Institutelocation not on record | 3 |
| AUAlocation not on record | 3 |
| Aarhus, DK | 3 |
| Honolulu, US | 3 |
| ROM003location not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Stockholm, SE | 3 |
| Madison, US | 3 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 3 |
| 3 | |
| Brisbane, AU | 3 |
| Toyama, JP | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Lincoln, US | 3 |
| Fayetteville, US | 3 |
| Adelaide, AU | 3 |
| Mohonk Preservelocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Toronto, CA | 3 |
| Henderson, US | 3 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| Beijing, CN | 2 |
| Umeå Universitylocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Anchorage, US | 2 |
| UChlocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Namur, BE | 2 |
| Monastir, TN | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| Institute for Biology of National Academy of Sci.location not on record | 2 |
| Hiratsuka City Museumlocation not on record | 2 |
| Portland, US | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| McWane Science Centerlocation not on record | 2 |
| Chicago, US | 2 |
| Tampa, US | 2 |
| Badajoz, ES | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Frauenfeld, CH | 2 |
| Fullerton, US | 2 |
| UoB-IBlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Rocky Mountain Biological Laboratorylocation not on record | 2 |
| AASlocation not on record | 2 |
| Palmerston North, NZ | 2 |
| H-Schuhwlocation not on record | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| San Jose, US | 2 |
| LfUlocation not on record | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Toyota city nature sanctuarylocation not on record | 1 |
| Culiacán, MX | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Johnson City, US | 1 |
| Banyoles, ES | 1 |
| Asheville, US | 1 |
| Cape Town, ZA | 1 |
| Université Lavallocation not on record | 1 |
| J. Rusek Collectionlocation not on record | 1 |
| Montréal, CA | 1 |
| Clemson, US | 1 |
| KMCClocation not on record | 1 |
| Kingston, US | 1 |
| Herb. BBGlocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Bothell, US | 1 |
| Tsukuba, JP | 1 |
| Saint John, CA | 1 |
| Brussel, BE | 1 |
| JP | 1 |
| Dhaka, BD | 1 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Loja, EC | 1 |
| Phoenix, US | 1 |
| Alicante, ES | 1 |
| Durham, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| BIO-UNIPIlocation not on record | 1 |
| PUC-RSlocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Winterthur, CH | 1 |
| Sion, CH | 1 |
| Coimbra, PT | 1 |
| Antiguo Cuscatlán, SV | 1 |
| Chicago, US | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| BISHlocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| PRClocation not on record | 1 |
| DASSHlocation not on record | 1 |
| Due West, US | 1 |
| ISAlocation not on record | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| KIWElocation not on record | 1 |
| KOMlocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Québec, CA | 1 |
| Macomb, US | 1 |
| SEFlocation not on record | 1 |
| Göteborg, SE | 1 |
| University of Nevadalocation not on record | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Kensington, AU | 1 |
| Santa Cruz, US | 1 |
| SIHUlocation not on record | 1 |
| Xining, CN | 1 |
| Appalachian State Universitylocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 1 |
| John T. Waterhouse Herbariumlocation not on record | 1 |
| Cape Town, ZA | 1 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 1 |
| Pittsburg, US | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| San Diego, US | 1 |
313 institutions · 13 043 of 14 328 vouchered records shown · 827 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA224 detections
Where the DNA of Arrhenatherum elatius was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found224
Studies independent surveys3
Countries22
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 224 detections have coordinates
Open the map22 countries0
in tall grassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 11.0–18.0
Seasonal swing summer↔winter19.7 °C
Max temp (day)19.9 °C 14.1–22.2
Min temp (night)10.4 °C 7.30–14.2
Precipitation71.6 mm/mo 55.2–92.8
Air humidity60.1 % 56.4–64.8
Moisture balance-20.6 mm/mo -51.7–19.0
Vapour deficit673 Pa 463–840
Wind speed3.50 m/s 2.40–4.10
Cloud cover41.2 % 35.3–47.9
CHELSA 1981–2010, ~9 km grid, at location & month of 181 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.