Arracacia xanthorrhiza

Bancr. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Arracacia

At a glance

Occurrence records437

Data sources9

Biological traits16

DNA specimens17

eDNA detections17

Sources9 archives

Databases and archives Arracacia xanthorrhiza's data was compiled from.

WikipediaWikimedia Foundation10 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility437 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionDukesPhytochem16 compounds

Occurrence & distributionGBIF437 records

Environmental DNA1 datasets · 1 countries17 detections

DNA & barcodingBOLD · NCBI17 specimens

01Narrative

Arracacha (Arracacia xanthorrhiza) is a root vegetable originally from the Andes, somewhat intermediate between the carrot and celery root. Its starchy taproot is a popular food item in South America where it is a major commercial crop.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height1 m

Life cycle & reproduction5

Life formperennial

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Self fertilizationpresent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 250 m

Elevation min1 200 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition16 compounds

Compounds documented for Arracacia xanthorrhiza across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking💊 Medicinal use documented

Documented compounds16 total

Tissue Source Quantified only

Compound	Amount	Source
CARBOHYDRATES	930,800 ppm	DukesPhytochem
WATER	711,000 ppm	DukesPhytochem
STARCH	250,000 ppm	DukesPhytochem
PROTEIN	34,600 ppm	DukesPhytochem
ASH	31,150 ppm	DukesPhytochem
FIBER	20,760 ppm	DukesPhytochem
KILOCALORIES	3,875 ppm	DukesPhytochem
FAT	3,460 ppm	DukesPhytochem
PHOSPHORUS	1,900 ppm	DukesPhytochem
ASCORBIC-ACID	1,070 ppm	DukesPhytochem

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arracacia xanthorrhiza has left across the world's sequence archives.

At a glance

DNA specimens17

Marker genes4

GenBank sequences10

eDNA detections17

Countries1

The DNA barcodea real sequence read deposited for this species

ITSGQ862445.1 ↗598 bp

ACGT

TCGAATCCTGCAATAGCAGAATTACCAGCTAACATGTCAACAATTTGGGCAAGCATCGGGGGGCCTCGGTCCCCTGTCTGCGAATCCCTG …

Arracacia xanthorrhiza voucher Blas 1 (COL) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★rbcLa★ITS7★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type437 records

Wild obs. + sensor14

Museum / vouchered83

Cultivated / captive326

Other14

Origin

Native1

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy27% within 1 km

≤100 m 3≤10 km 1>10 km 7

11 georeferenced · 3 without coordinates

Open the mapobservation + sensor14

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 3≤10 km 7>10 km 2

12 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence83

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤1 km 1≤10 km 29>10 km 210

240 georeferenced · 86 without coordinates

Open the mapnot free-living326

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	12
Universidad Nacional de Colombia (UNAL)location not on record	11
National Biodiversity Institute, Costa Ricalocation not on record	9
Puerto Ayora, EC	6
Universidad Católica de Oriente (UCO)location not on record	4
Museo Nacional de Costa Rica (MNCR)location not on record	4
Bronx, US	4
Istituto Agrario Castelnuovolocation not on record	3
Universidad de Caldas (UCaldas)location not on record	3
Universidad de Antioquia (UdeA)location not on record	3
Chicago, US	2
Universidad del Quindío (UniQuindío)location not on record	2
Universidad de Nariño (UdeNar)location not on record	2
Antiguo Cuscatlán, SV	2
Cuenca, EC	2
Kew, GB	1
Loja, EC	1
Berlin, DE	1
QCNElocation not on record	1
Quito, EC	1
Ivano-Frankivsk, UA	1
Instituto Nacional de Biodiversidad Herbario, Costa Ricalocation not on record	1
UNESP-FCAlocation not on record	1
Universidad Industrial de Santander (UIS)location not on record	1
Xiamen, CN	1
Miami, US	1
FUNEDlocation not on record	1
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	1
Cusco, PE	1

29 institutions · 83 of 83 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA17 detections

Where the DNA of Arracacia xanthorrhiza was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 25.6–25.6

Seasonal swing summer↔winter1.20 °C

Max temp (day)27.2 °C

Min temp (night)23.6 °C

Precipitation690 mm/mo

Air humidity72.1 %

Moisture balance550 mm/mo

Vapour deficit911 Pa

Wind speed0.5 m/s

Cloud cover36.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)