Arracacia filipes

Mathias & Constance · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Arracacia

At a glance

Occurrence records8

Data sources9

Biological traits2

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Arracacia filipes's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF8 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 44

01Narrative

Arracacia filipes is a plant species native to the Mexican State of Durango. It grows in moist, shaded areas in forests and canyons at elevations of 2000 -.Davidse, G., M. Sousa Sánchez, S. Knapp & F. Chiang Cabrera. 2009. Cucurbitaceae a Polemoniaceae. 4(1): i–xvi, 1–855. In G. Davidse, M. Sousa Sánchez, S. Knapp & F. Chiang Cabrera (eds.) Flora Mesoamericana. Universidad Nacional Autónoma de México, México. Arracacia filipes is a biennial herb with a large taproot. It produces a slender, purplish stem up to 1.5 m tall. Leaves are up to 60 cm long, biternate or bipinnate, with ovate, doubly toothed leaflets. Flowers are green.Mathias, Mildred Esther, & Constance, Lincoln. 1973. New and reconsidered Mexican Umbelliferae. Contributions from the University of Michigan Herbarium 11(1): 1–24

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatedesert or dry shrubland

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arracacia filipes has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSGQ862399.1 ↗599 bp

ACGT

TCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTCAACAATTTGGGCAAGCGTCGGGGGGCCTCGGTCTCCTGTCTGTTAATCCCTG …

Arracacia filipes voucher Breedlove 18922 (MICH) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arracacia filipes carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 44 n = 22

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 222×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Constance, L., T. i. Chuang & C. R. Bell. 1976. Chromosome numbers in Umbelliferae. V. Amer. J. Bot. 63(5): 608–625.

CCDB · ipcn-api-dl — Mathias, M. E. & L. Constance. 1973. New and reconsidered Mexican Umbelliferae. Contr. Univ. Michigan Herb. 11(1): 1–24.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type8 records

Wild obs. + sensor2

Museum / vouchered6

Range

Area of Occupancy AOO32 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 1≤10 km 1

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 1≤1 km 1≤10 km 1>10 km 1

4 georeferenced · 2 without coordinates

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	4
Riverside, US	1
Durango, MX	1

3 institutions · 6 of 6 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Arracacia filipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)