Arnoglossum floridanum

(A.Gray) H.Rob. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arnoglossum

At a glance

Occurrence records753

Data sources10

Biological traits7

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Arnoglossum floridanum's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility753 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionNPASS15 compounds

Occurrence & distributionGBIF753 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 52

01Narrative

Arnoglossum floridanum, the Florida cacalia, is a Florida species of plants in the sunflower family.Flora of North America Vol. 20 Page 624 Arnoglossum floridanum (A. Gray) H. Robinson, Phytologia. 28: 294. 1974. Arnoglossum floridanum is a plant growing up to 100 cm (40 inches) tall. Flower heads are white or pale green. The species grows in dry sandy ridges and pine-oak forests in central Florida.Biota of North America Program 2014 county distribution map

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition15 compounds

Compounds documented for Arnoglossum floridanum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Flavonols10

Flavanones2

Flavones1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(2R)-2-(3,4-dihydroxyphenyl)-5,7,8-trihydroxy-2,3-dihydrochromen-4-one	present	NPASS
(2R)-5,7,8-trihydroxy-2-(4-hydroxyphenyl)-2,3-dihydrochromen-4-one	present	NPASS
3-[(2R,3R,4R,5R,6S)-4,5-dihydroxy-6-methyl-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5,7-dihydroxychromen-4-one	present	NPASS
3-[(2R,3R,4R,5R,6S)-4,5-dihydroxy-6-methyl-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5,7-dihydroxy-2-(3,4,5-trihydroxyphenyl)chromen-4-one	present	NPASS
3-[(2R,3R,4R,5R,6S)-4,5-dihydroxy-6-methyl-3-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5,7-dihydroxy-2-(4-hydroxyphenyl)chromen-4-one	present	NPASS
5,7-Dihydroxy-2-(4-hydroxyphenyl)-3-(((2r,3s,4r,5r)-3,4,5-trihydroxytetrahydro-2h-pyran-2-yl)oxy)-4h-chromen-4-one	present	NPASS
5,7-dihydroxy-3-[(2R,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-2-(3,4,5-trihydroxyphenyl)chromen-4-one	present	NPASS
Hypolaetin	present	NPASS
Kaempferol	present	NPASS
kaempferol-3-O-alpha-L-rhamnoside	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arnoglossum floridanum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes4

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ418358.1 ↗634 bp

ACGT

TCAAAACCCGCATAGCTAACCACCCGTGGACTCGTAATAATATCTAGGTGTCTTTGTCTCGAGCTTTTGTTGATACTTTGTATGCCTTGT …

Arnoglossum floridanum voucher TENN:Beck 9096 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL2★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arnoglossum floridanum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 261×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — JONES, S.B., JR. 1970. Chromosome numbers in Compositae. Bull. Torrey Bot. Club. 97: 168-174.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type753 records

Wild obs. + sensor633

Museum / vouchered120

Range

Area of Occupancy AOO1 388 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 357≤1 km 70≤10 km 25>10 km 44

496 georeferenced · 137 without coordinates

Open the mapobservation + sensor633

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1>10 km 6

7 georeferenced · 113 without coordinates

Open the institutions mapphysical evidence120

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tampa, US	43
Jena Microbial Resource Collectionlocation not on record	39
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	21
Miami, US	5
Bangkok, TH	4
Chapel Hill, US	2
Wuzhou, CN	1
Tall Timbers Research Stationlocation not on record	1

8 institutions · 116 of 120 vouchered records shown · 4 without an institution code

09Environmental DNA1 detections

Where the DNA of Arnoglossum floridanum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)