Arnica rydbergii

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arnica

At a glance

Occurrence records635

Data sources11

Biological traits7

DNA specimens5

eDNA detections3

Sources11 archives

Databases and archives Arnica rydbergii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility635 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF635 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 76

01Narrative

Arnica rydbergii is a North American species of flowering plant in the family Asteraceae, known by the common name Rydberg's arnica or subalpine arnica or subalpine leopardbane.Flora of North America, Rydberg’s arnica, Arnica rydbergiiMontana field guide, Subalpine Arnica - Arnica rydbergiiWildflowers West, Subalpine Arnica (Arnica rydbergii)Paul Slichter, Arnicas East of the Cascade Mts. of Oregon and Washington, Rydberg's Arnica, Subalpine Arnica, Subalpine Leopardbane Arnica rydbergii It is native to western Canada (Alberta, British Columbia), and the western United States (Alaska, Washington, Oregon, Utah, Idaho, Montana, Utah, Wyoming, Colorado, South Dakota).Biota of North America Program 2014 county distribution map Arnica rydbergii is an herb up to 35 cm (14 inches) tall. Flower heads are yellow, with both ray florets and disc florets. It grows in alpine meadows and rocky slopes at high altitudes in mountainous areas.Greene, Edward Lee 1899. Pittonia 4(20D): 36–37 The species is named for Swedish-American botanist Per Axel Rydberg, 1860–1931.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition3 compounds

Compounds documented for Arnica rydbergii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavonols2

Flavones1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
Astragalin	present	LOTUS
Hyperin	present	LOTUS
Luteolin 7-glucoside	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arnica rydbergii has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG219311.1 ↗349 bpCanada · 1965

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Arnica rydbergii voucher 33850aHIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arnica rydbergii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 76 n = 38

Ploidypolyploid inferred

Chromosome records38–762n range76median76mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 762×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wolf, S. J. 1987. Cytotaxonomic studies in the genus Arnica (Compositae: Senecioneae). Rhodora 89: 391–400.

CCDB · ipcn-api-dl — Straley, G. B. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 278.

2n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wolf, S. J. 1980. Cytogeographical studies in the genus Arnica (Compositae : Senecioneae). I. Amer. J. Bot. 67: 300–308.

n 191×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wolf, S. J. 1980. Cytogeographical studies in the genus Arnica (Compositae : Senecioneae). I. Amer. J. Bot. 67: 300–308.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type635 records

Wild obs. + sensor83

Museum / vouchered552

Range

Area of Occupancy AOO1 848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 40≤1 km 8≤10 km 3>10 km 1

52 georeferenced · 31 without coordinates

Open the mapobservation + sensor83

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 37≤1 km 93≤10 km 121>10 km 6

257 georeferenced · 295 without coordinates

Open the institutions mapphysical evidence552

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions34 of 50 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Missoula, US	76
University of Alberta Museumslocation not on record	49
WTUlocation not on record	44
Pullman, US	42
Bronx, US	41
DOI/NPS, Colonial National Historical Parklocation not on record	37
Vancouver, CA	30
Moscow, US	24
Rocky Mountain Biological Laboratorylocation not on record	23
Boise, US	20
Musee des Dinosaures d'Esperaza (Aude)location not on record	19
Victoria, CA	19
Bozeman, US	14
Denver, US	14
Pocatello, US	13
Corvallis, US	12
Logan, US	8
DOI/NPS, Greenbelt Parklocation not on record	7
Caldwell, US	5
Saint Louis, US	4
Provo, US	4
Turlock, US	3
Portland, US	3
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	3
Spearfish, US	3
Chongqing Museumlocation not on record	2
Johnson City, US	2
University of Guelph, OAC Herbariumlocation not on record	2
University of Stellenboschlocation not on record	2
Pittsburg, US	2
Macomb, US	1
DOI/NPS, Mount Rainier National Parklocation not on record	1
Bloomington, US	1
Durango, US	1
Université Lavallocation not on record	1
Bangkok, TH	1
Orem, US	1
St. Paul, US	1
AUAlocation not on record	1
Moscow State Universitylocation not on record	1
University of Lethbridgelocation not on record	1
Albuquerque, US	1
San Angelo, US	1
Chadron, US	1
Riverside, US	1
New Brunswick, US	1
Ashland, US	1
Wuzhou, CN	1
BOISlocation not on record	1
Tempe, US	1

50 institutions · 547 of 552 vouchered records shown · 5 without an institution code

09Environmental DNA3 detections

Where the DNA of Arnica rydbergii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 11.2–11.2

Seasonal swing summer↔winter25.4 °C

Max temp (day)17.2 °C

Min temp (night)5.80 °C

Precipitation46.1 mm/mo

Air humidity56.4 %

Moisture balance-85.2 mm/mo

Vapour deficit585 Pa

Wind speed1.90 m/s

Cloud cover36.8 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)