Arnica ovata

Greene · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arnica

At a glance

Occurrence records258

Data sources10

Biological traits11

DNA specimens7

eDNA detections5

Sources10 archives

Databases and archives Arnica ovata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility258 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Occurrence & distributionGBIF258 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 76

01Narrative

Arnica ovata is a North American species of flowering plant in the family Asteraceae, known by the common name sticky leaf arnica.Flora of North America, Sticky leaf arnica, Arnica ovataCalflora taxon report, University of California, Arnica ovata Greene Sticky leaf arnica It is native to western Canada (Yukon, Alberta, British Columbia), and the western United States (Alaska, Washington, Oregon, California, Nevada, Utah, Idaho, Montana, Wyoming, Colorado).Biota of North America Program 2014 state-level distribution map Arnica ovata is an herb up to 50 cm (20 inches) tall. Flower heads are yellow, with both ray florets and disc florets. It grows in meadows and coniferous forests in mountainous areas.Greene, Edward Lee 1900. Pittonia 4(23): 161

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRYGIFT

Size & morphology4

Plant height0.381 m

Seed mass1.35 mg

Seed mass max1.36 mg

Seed mass min1.36 mg

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arnica ovata has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes4

GenBank sequences2

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG218041.1 ↗351 bpCanada · 1946

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGTTGAGGGCACGTCTGCTTGGGCGTCACGCATC …

Arnica ovata voucher CCDB-24795-D08 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arnica ovata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 76 n = 38

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 381×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wolf, S. J. 1980. Cytogeographical studies in the genus Arnica (Compositae : Senecioneae). I. Amer. J. Bot. 67: 300–308.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type258 records

Wild obs. + sensor4

Museum / vouchered254

Origin

Native1

Range

Area of Occupancy AOO812 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 2 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 25≤1 km 35≤10 km 78>10 km 1

139 georeferenced · 115 without coordinates

Open the institutions mapphysical evidence254

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museumslocation not on record	77
Pullman, US	32
Moscow, US	32
Bronx, US	31
Logan, US	21
Victoria, CA	7
WTUlocation not on record	7
Vancouver, CA	3
Yukon Universitylocation not on record	3
Research Collection of B. A. Bennettlocation not on record	2
CASlocation not on record	2
Pocatello, US	2
Canadian Department of Agriculturelocation not on record	2
Northridge, US	1
Claremont, US	1
Davis, US	1
Columbia, US	1
San Diego, US	1
Severin-McDaniel Insect Collectionlocation not on record	1
DOI/NPS, Mount Rainier National Parklocation not on record	1
Pittsburg, US	1

21 institutions · 229 of 254 vouchered records shown · 25 without an institution code

09Environmental DNA5 detections

Where the DNA of Arnica ovata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

skree ground

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.30 °C 7.20–11.4

Seasonal swing summer↔winter25.3 °C

Max temp (day)12.6 °C 9.40–15.8

Min temp (night)4.80 °C 4.00–5.50

Precipitation73.7 mm/mo 52.7–94.7

Air humidity59.7 % 56.8–62.5

Moisture balance-47.8 mm/mo -66.8–-28.8

Vapour deficit488 Pa 386–589

Wind speed3.80 m/s 2.90–4.70

Cloud cover41.3 % 41.1–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)