Arnica louiseana

Farr · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Arnica

At a glance

Occurrence records74

Data sources11

Biological traits7

DNA specimens5

eDNA detections2

Sources11 archives

Databases and archives Arnica louiseana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 76

01Narrative

Arnica louiseana is a Canadian species of flowering plant in the family Asteraceae, known by the common name Lake Louise arnica or snow arnica.Flora of North America, Lake Louise arnica, snow arnica, Arnica louiseanaBiota of North America Program 2014 state-level distribution map It is native to the Canadian Rockies in Alberta and British Columbia, and named for Lake Louise in Banff National Park. Arnica louiseana is a small plant rarely more than 20 cm (8 inches) tall. Flower heads are yellow, with both ray florets and disc florets. It grows at high elevations in alpine tundra and rocky outcrops.Farr, Edith May 1906. Ottawa Naturalist 20(5): 109

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Arnica louiseana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavonols3

Flavones1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
Apiumetrin	present	LOTUS
Astragalin	present	LOTUS
Hyperin	present	LOTUS
Kaempferol 3-O-beta-D-galactopyranoside	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Arnica louiseana has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG218003.1 ↗349 bpCanada · 1948

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATC …

Arnica louiseana voucher CCDB-22993-B11 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Arnica louiseana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 76 n = 38

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 761×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Downie, S. R. & K. E. Denford. 1986. The taxonomy of Arnica frigida and A. louiseana (Asteraceae). Canad. J. Bot. 64: 1355–1372.

2n 951×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Straley, G. B. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 579.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type74 records

Wild obs. + sensor22

Museum / vouchered52

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 8≤1 km 4≤10 km 1>10 km 2

15 georeferenced · 7 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy24% within 1 km

≤1 km 7≤10 km 19>10 km 3

29 georeferenced · 23 without coordinates

Open the institutions mapphysical evidence52

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museumslocation not on record	25
Provo, US	12
Vancouver, CA	3
Victoria, CA	2
University of Stellenboschlocation not on record	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Canadian Museum of Naturelocation not on record	1
Bronx, US	1
WTUlocation not on record	1
Chongqing Museumlocation not on record	1
Bozeman, US	1
Université Lavallocation not on record	1
Trondheim, NO	1

13 institutions · 52 of 52 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Arnica louiseana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)